Dataset for CDS classical BH3-containing proteins of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       --------------------atgttccagatcccagagtttgagcctagt
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggaaccctcggctgcccggcggagtgcggcggcgggctggcgggaaggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggaaccctcggctgcccggcggagtgcggcggcgggctggcgggaaggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       gagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       ggggaacaggccctcagactccggcaagcatcatcgccaggccccaggcc
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       tcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       -atgctgtctttttgccccaaaggagaaatgtctggagtaagacccatct
A0A2K5VPX2_PMAIP1-      -----------atgcctgggaagaaggcgcgcaagaacgcgcaaccgagc
A0A7N9CRT3_BMF-02       --------------------------------atggag------cc--at
A0A7N9CRT3_BMF-01       --------------------------------atggag------cc--at
A0A7N9CRT3_BMF-03       --------------------------------atggag------cc--at
A0A2K5V8L0_BBC3-01      --------------------------------ataaaa-----------t
A0A2K5VCA1_BAD-01       catggaggcgctggggctgtggagacccggagtcgccacagctcct--ac
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaacc--tt

A0A2K5VW94_BIK-01       ccagagacacctt-----gatggagaccctcctgtatgagcagctcctgg
A0A2K5VPX2_PMAIP1-      ccaacgcgggctc-----aggcaggaccggggactgcaggga----cggc
A0A7N9CRT3_BMF-02       ctcg--------------gtgtgtggaggagctggaggatgatgtgttcc
A0A7N9CRT3_BMF-01       ctcg--------------gtgtgtggaggagctggaggatgatgtgttcc
A0A7N9CRT3_BMF-03       ctcg--------------gtgtgtggaggagctggaggatgatgtgttcc
A0A2K5V8L0_BBC3-01      ttggcgtggggtctgcccgggcatgtccatgccaggtgccca----gggc
A0A2K5VCA1_BAD-01       cccgcggggacgga----ggaggacgaagggatggaggagga----gccc
Q2PG01_BAD-01           -------------------------------atggaggagga----gccc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc
A0A2K5X1Y3_BCL2L11      ctgatgtaagttct----gagtgtgaccgagaaggtagacaa----ttgc

A0A2K5VW94_BIK-01       aacccctaaccatggaggttcttggtgtcactgaccctgaagaggacctg
A0A2K5VPX2_PMAIP1-      agggacg----gcgaggg-----accaggccggattt------gggattg
A0A7N9CRT3_BMF-02       agc--cg----gaggacg-----gggagccggggtcc------caacccg
A0A7N9CRT3_BMF-01       agc--cg----gaggacg-----gggagccggggtcc------caacccg
A0A7N9CRT3_BMF-03       agc--cg----gaggacg-----gggagccggggtcc------caacccg
A0A2K5V8L0_BBC3-01      ttcttct----gcgacgt-----gg-gtcccctgc-c------agatttg
A0A2K5VCA1_BAD-01       agc--cc----ctttcgg-----ggccgctcgcgctc------cgcgcc-
Q2PG01_BAD-01           agc--cc----ctttcgg-----ggccgctcgcgctc------cgcgcc-
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg
A0A2K5X1Y3_BCL2L11      agc--ct----gcggaga-----ggcctccccagctc------agacctg

A0A2K5VW94_BIK-01       ga-----------------------ccctatggaggacttcgatcctttg
A0A2K5VPX2_PMAIP1-      ggatgcagctgcattacaccagaggcaaaaagctcgtctcctcctcccca
A0A7N9CRT3_BMF-02       gg---------------------------------agctctctctctg--
A0A7N9CRT3_BMF-01       gg---------------------------------agctctctctctg--
A0A7N9CRT3_BMF-03       gg---------------------------------agctctctctctg--
A0A2K5V8L0_BBC3-01      tg---------------------------------gtcctcagccctcgc
A0A2K5VCA1_BAD-01       ------------------------------------ccccaacctctg--
Q2PG01_BAD-01           ------------------------------------ccccaacctctg--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
A0A2K5X1Y3_BCL2L11      gg---------------------------------gcccctacctccc--
                                                             *       *    

A0A2K5VW94_BIK-01       gagtgtatggaggacagtgacatg-----------ttggccctgcggctg
A0A2K5VPX2_PMAIP1-      cttgtccttccg--cggggccacgaggaacaagtgcaagtagctcga---
A0A7N9CRT3_BMF-02       ccgatctgtttgcccagagcctac-----------ttgactgccccctca
A0A7N9CRT3_BMF-01       ccgatctgtttgcccagagcctac-----------ttgactgccccctca
A0A7N9CRT3_BMF-03       ccgatctgtttgcccagagcctac-----------ttgactgccccctca
A0A2K5V8L0_BBC3-01      tcttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggg
A0A2K5VCA1_BAD-01       -------ggcagcacagcgttatg--------------------------
Q2PG01_BAD-01           -------ggcagcacagcgttatg--------------------------
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccaca--------------------------
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccaca--------------------------
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccacaa-------------------------
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccaca--------------------------
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccacaaggtaatcccgaaggcaatcacggag
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccacaaggtaatcccgaaggcaatcacggag
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccacaaggtaatcccgaaggcaatcacggag
A0A2K5X1Y3_BCL2L11      -------tacag-acagagccacaaggtaatcccgaaggcaatcacggag
                                   *  * *                                 

A0A2K5VW94_BIK-01       gcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggc
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       gccgacttcagctcttccctctcacccactgctgtggccctggccttcga
A0A7N9CRT3_BMF-01       gccgacttcagctcttccctctcacccactgctgtggccctggccttcga
A0A7N9CRT3_BMF-03       gccgacttcagctcttccctctcacccactgctgtggccctggccttcga
A0A2K5V8L0_BBC3-01      gccctggcgggcggtcccacccaggcggccccgggagtccgcgaggagga
A0A2K5VCA1_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
A0A2K5X1Y3_BCL2L11      gtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
A0A2K5X1Y3_BCL2L11      gtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
A0A2K5X1Y3_BCL2L11      gtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca

A0A2K5VW94_BIK-01       ccagctctc-----------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       cccaccagccagga------------------------------------
A0A7N9CRT3_BMF-01       cccaccagccagga------------------------------------
A0A7N9CRT3_BMF-03       cccaccagccagga------------------------------------
A0A2K5V8L0_BBC3-01      acagtgggcccggg------------------------------------
A0A2K5VCA1_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2K5X1Y3_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2K5X1Y3_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat
A0A2K5X1Y3_BCL2L11      ccggccagccctggcccttttgctaccagatccccgcttttcatctttat

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       --------------------------------------------------
A0A7N9CRT3_BMF-01       --------------------------------------------------
A0A7N9CRT3_BMF-03       --------------------------------------------------
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2K5X1Y3_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2K5X1Y3_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg
A0A2K5X1Y3_BCL2L11      gagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttg

A0A2K5VW94_BIK-01       ----tgaggtggccatgcacagcctgggtctggctttcatctacga----
A0A2K5VPX2_PMAIP1-      ----agtcgag----------tgtgctactcaactcaggagatttg----
A0A7N9CRT3_BMF-02       ----agacaaggccacccagaccctcggcccagcctcccccagccaaggt
A0A7N9CRT3_BMF-01       ----agacaaggccacccagaccctcggcccagcctcccccagccaaggt
A0A7N9CRT3_BMF-03       ----agacaaggccacccagaccctcggcccagcctcccccagccaaggt
A0A2K5V8L0_BBC3-01      ----agatcgg---------------ggcccagctgcggcggatgg----
A0A2K5VCA1_BAD-01       -----------------------------------gccgcgagctc----
Q2PG01_BAD-01           -----------------------------------gccgcgagctc----
A0A2K5X1Y3_BCL2L11      ----agacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      ----agacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ----agacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      acacagacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      acacagacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      acacagacagg---------------agcccagcacccatgagttg----
A0A2K5X1Y3_BCL2L11      acacagacagg---------------agcccagcacccatgagttg----

A0A2K5VW94_BIK-01       ------------------ccagatggacgacatcagggatgttcttagaa
A0A2K5VPX2_PMAIP1-      -----------------------gagacaaactgaa--------------
A0A7N9CRT3_BMF-02       gtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacgg
A0A7N9CRT3_BMF-01       gtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacgg
A0A7N9CRT3_BMF-03       gtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacgg
A0A2K5V8L0_BBC3-01      -----------------------cggacgacctcaacgcgcaatacgagc
A0A2K5VCA1_BAD-01       -----------------------cggagga--tgagtgacgagtttgtgg
Q2PG01_BAD-01           -----------------------cggagga--tgagtgacgagtttgtgg
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt
A0A2K5X1Y3_BCL2L11      -----------------------tgacaaa--tcaacacaaaccccaagt

A0A2K5VW94_BIK-01       g---------------------tttcatggatggtttc--acca------
A0A2K5VPX2_PMAIP1-      ----------------------cttccggcagaaacttct----------
A0A7N9CRT3_BMF-02       caatgctggctaccggcttcctctccctgccagtttcccggcagtcttgc
A0A7N9CRT3_BMF-01       caatgctggctaccggcttcctctccctgccagtttcccggcagtcttgc
A0A7N9CRT3_BMF-03       caatgctggctaccggcttcctctccctgccagtttcccggcagtcttgc
A0A2K5V8L0_BBC3-01      g---------------------gcggagacaagaggagcagcag------
A0A2K5VCA1_BAD-01       a---------------------ctcctttaagggactt---cct------
Q2PG01_BAD-01           a---------------------ctcctttaaggggctt---cct------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------
A0A2K5X1Y3_BCL2L11      c---------------------ctccttgccaggccttcaacca------

A0A2K5VW94_BIK-01       cccttagggagaacataatgaggttctggag--------------atccc
A0A2K5VPX2_PMAIP1-      gaatctgatagccaaactcttctgctcagga-------------------
A0A7N9CRT3_BMF-02       ccatcggggagcag-------ccccccgaag-------------------
A0A7N9CRT3_BMF-01       ccatcggggagcag-------ccccccgaag-------------------
A0A7N9CRT3_BMF-03       ccatcggggagcag-------ccccccgaag-------------------
A0A2K5V8L0_BBC3-01      cga--------caccgcccctcgccctggag-------------------
A0A2K5VCA1_BAD-01       cgcccgaagagcgcggg-------cacagcg-------------------
Q2PG01_BAD-01           cgcccgaagagcgcggg-------cacagcg-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatggtagtcatcctagaggatataggtgatagttcat
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg---------atgag-------------------
A0A2K5X1Y3_BCL2L11      ----------------g----cttccaggag-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg----cttccaggag-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg----cttccaggag-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg----cttccaggag-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg----cttccaggag-------------------
A0A2K5X1Y3_BCL2L11      ctatctcagtgcaatgg----cttccaggag-------------------

A0A2K5VW94_BIK-01       cgaatcccaggtcctgggtgtcccgtgaacaggtgctgctggtgctgctg
A0A2K5VPX2_PMAIP1-      ---acctgactgcatcaaaaacttgcataaggggactccaaaagagactt
A0A7N9CRT3_BMF-02       ----ggcagtggcaaca-----tcgagcagaggtac--------aga---
A0A7N9CRT3_BMF-01       ----ggcagtggcaaca-----tcgagcagaggtac--------aga---
A0A7N9CRT3_BMF-03       ----ggcagtggcaaca-----tcgagcagaggtac--------aga---
A0A2K5V8L0_BBC3-01      --------ggtcctgtacaatctcatcatgggactc--------ctgccc
A0A2K5VCA1_BAD-01       ---acgcagatgcggcaaagctccagctgga--cgc--------gag---
Q2PG01_BAD-01           ---acgcagatgcggcaaagctccagctgga--cgc--------gag---
A0A2K5X1Y3_BCL2L11      tgtggtttggatttatatttactggcttaga--ttt--------gta---
A0A2K5X1Y3_BCL2L11      -gccactggatcct---------ccctcgga---------------a---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---
A0A2K5X1Y3_BCL2L11      -gcaggctgaacctgcagatatgcgcccggagatac--------gga---

A0A2K5VW94_BIK-01       ctgctgctggcactgctgctggcgctgctcagc----------gggggcc
A0A2K5VPX2_PMAIP1-      tttct-caggaggtgcacacttcatcaatttga----------agaaaga
A0A7N9CRT3_BMF-02       ttgcc-cgaaagcttca------gtgcattgca----------gaccagt
A0A7N9CRT3_BMF-01       ttgcc-cgaaagcttca------gtgcattgca----------gaccagt
A0A7N9CRT3_BMF-03       ttgcc-cgaaagcttca------gtgcattgca----------gaccagt
A0A2K5V8L0_BBC3-01      ttacc-caggggccaca------gagcccccgaa---------atggagc
A0A2K5VCA1_BAD-01       tcttc-cagtcctggtg------gg--atcggaacttgggcaggggaagc
Q2PG01_BAD-01           tcttc-cagtcctggtg------gg--atcggaacttgggcaggggaagc
A0A2K5X1Y3_BCL2L11      tggcc-acc------------------accaca----------gtcaaga
A0A2K5X1Y3_BCL2L11      ttgcc-c--------------------ttcata----------gggaagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt
A0A2K5X1Y3_BCL2L11      tcgcc-caagagttgcg------gcgaattgga----------gacgagt

A0A2K5VW94_BIK-01       tgcacctgctgctca-----------------------------------
A0A2K5VPX2_PMAIP1-      tt-----gcattgta-----------------------------------
A0A7N9CRT3_BMF-02       tccaccggctccatgtgcagcaa---------aaccgaaatcgcgtgtgg
A0A7N9CRT3_BMF-01       tccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
A0A7N9CRT3_BMF-03       tccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
A0A2K5V8L0_BBC3-01      cca-----------------------------------------------
A0A2K5VCA1_BAD-01       tccgc--accctccc-----------------------------------
Q2PG01_BAD-01           tccgc--accctccc-----------------------------------
A0A2K5X1Y3_BCL2L11      tacag--aacaactcaaccacaaggatttct-------------------
A0A2K5X1Y3_BCL2L11      tcagt--ggccgct----cgagtggttagcatcaa---------------
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggaggttg----------------------
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggagggtatttttgaataattaccaagcag
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggagggtatttttgaataattaccaagcag
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggagggtatttttgaataattaccaagcag
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggaggatgtcgct-----------------
A0A2K5X1Y3_BCL2L11      ttaac--gcttactatgcaaggaggttagag-------------------

A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A7N9CRT3_BMF-02       tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaa
A0A7N9CRT3_BMF-01       tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaa
A0A7N9CRT3_BMF-03       tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaa
A0A2K5V8L0_BBC3-01      --------------------------------------------------
A0A2K5VCA1_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --gcagaactcc----------------------------tggcatcctc
A0A2K5X1Y3_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5X1Y3_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5X1Y3_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5X1Y3_BCL2L11      ------------------------------------------------tc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------

A0A2K5VW94_BIK-01       -------------------ag-----------------------------
A0A2K5VPX2_PMAIP1-      -------------------at-----------------------------
A0A7N9CRT3_BMF-02       caggaacggggcgggccctagg----------------------------
A0A7N9CRT3_BMF-01       caggaacggggcgggccctagg----------------------------
A0A7N9CRT3_BMF-03       caggaacggggcgggccctaggcccctgacctggaatggggctgttgtca
A0A2K5V8L0_BBC3-01      -------------------at-----------------------------
A0A2K5VCA1_BAD-01       -------------------ag-----------------------------
Q2PG01_BAD-01           -------------------ag-----------------------------
A0A2K5X1Y3_BCL2L11      -------------------ca-----------------------------
A0A2K5X1Y3_BCL2L11      -------------------gc-----------------------------
A0A2K5X1Y3_BCL2L11      cacctga-------------------------------------------
A0A2K5X1Y3_BCL2L11      cgcctggtgtggagaatgcat-----------------------------
A0A2K5X1Y3_BCL2L11      cgcctggtgtggagaatgcat-----------------------------
A0A2K5X1Y3_BCL2L11      cgcctggtgtggagaatgcat-----------------------------
A0A2K5X1Y3_BCL2L11      cacctg-------------at-----------------------------
A0A2K5X1Y3_BCL2L11      -----a-------------aa-----------------------------

A0A2K5VW94_BIK-01       --------tga
A0A2K5VPX2_PMAIP1-      --------tgg
A0A7N9CRT3_BMF-02       --------tga
A0A7N9CRT3_BMF-01       --------tga
A0A7N9CRT3_BMF-03       aaccctgttga
A0A2K5V8L0_BBC3-01      --------tag
A0A2K5VCA1_BAD-01       --------tga
Q2PG01_BAD-01           --------tga
A0A2K5X1Y3_BCL2L11      --------tga
A0A2K5X1Y3_BCL2L11      --------taa
A0A2K5X1Y3_BCL2L11      -----------
A0A2K5X1Y3_BCL2L11      --------tga
A0A2K5X1Y3_BCL2L11      --------tga
A0A2K5X1Y3_BCL2L11      --------tga
A0A2K5X1Y3_BCL2L11      --------taa
A0A2K5X1Y3_BCL2L11      --------tag

© 1998-2022Legal notice