Dataset for CDS classical BH3-containing proteins of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5VPX2_PMAIP1-      atg-----------------------cctgg-------------------
A0A2K5VPX2_PMAIP1-      atg-----------------------cctgg-------------------
A0A2K5VW94_BIK-01       atg-----------------------tctggagtaagacccatctccaga
A0A2K5V8J3_BBC3-03      ataaaa--------------------tttggcgtggggtctgcccg----
A0A2K5VLE9_BMF-01       atggagcc----------------atctcggtgtgtggaggagctggagg
A0A2K5VLE9_BMF-02       atggagcc----------------atctcggtgtgtggaggagctggagg
A0A2K5X1Y3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----g--ag
A0A2K5X1Y3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgacc-----g--ag
A0A2K5VCA9_BAD-03       atgttccag---------------atcccagagtttgagcctagtg--ag
A0A2K5VCA9_BAD-02       atgttccag---------------atcccagagtttgagcctagtg--ag
Q2PG01_BAD-01           atgg----------------------------------------------
                        **                                                

A0A2K5VPX2_PMAIP1-      --------gaagaaggcgcgc---------aagaacgcgcaaccgagccc
A0A2K5VPX2_PMAIP1-      --------gaagaaggcgcgc---------aagaacgcgcaaccgagccc
A0A2K5VW94_BIK-01       gacaccttgatggagaccctcctgtatgagcagctcctggaacccctaac
A0A2K5V8J3_BBC3-03      --------ggcatgtccatgccaggtgcc------cagggcttcttctgc
A0A2K5VLE9_BMF-01       at------gatgtgttccagccggaggacggggagccggggtcc-----c
A0A2K5VLE9_BMF-02       at------gatgtgttccagccggaggacggggagccggggtcc-----c
A0A2K5X1Y3_BCL2L11      aa------ggtagacaattgcagcctgcggagaggcct---ccccagctc
A0A2K5X1Y3_BCL2L11      aa------ggtagacaattgcagcctgcggagaggcct---ccccagctc
A0A2K5VCA9_BAD-03       ca------ggaagactccagctctgcagagaggggcctgggccccagccc
A0A2K5VCA9_BAD-02       ca------ggaagactccagctctgcagagaggggcctgggccccagccc
Q2PG01_BAD-01           -a------ggaggagcccagcccctt---tcggggcc---gctcgcgctc
                                *           *              *       *     *

A0A2K5VPX2_PMAIP1-      aacgcggg---------------------------------------ctc
A0A2K5VPX2_PMAIP1-      aacgcggg---------------------------------------ctc
A0A2K5VW94_BIK-01       catggagg----------------ttcttggtgtcactgaccctgaagag
A0A2K5V8J3_BBC3-03      gacgtggg------tcccctgccagatttgtggtcctcagccctcgctct
A0A2K5VLE9_BMF-01       aacccgggagctctctctctgccgatctgtttgcccagagcctacttgac
A0A2K5VLE9_BMF-02       aacccgggagctctctctctgccgatctgtttgcccagagcctacttgac
A0A2K5X1Y3_BCL2L11      agacctgg-----------------------ggcccctacctccc--tac
A0A2K5X1Y3_BCL2L11      agacctgg-----------------------ggcccctacctccc--tac
A0A2K5VCA9_BAD-03       cgcggggg--------------------acaggccctcagactcc--ggc
A0A2K5VCA9_BAD-02       cgcggggg--------------------acaggccctcagactcc--ggc
Q2PG01_BAD-01           cgc----------------------------gccccccaacctct--ggg
                                                                          

A0A2K5VPX2_PMAIP1-      aggcag--------------------------------------------
A0A2K5VPX2_PMAIP1-      aggcaggaca----ggcagggacggcagggacggcgagggaccaggccgg
A0A2K5VW94_BIK-01       gacctggaccctatggaggacttcaatcctttggagtg----tatggagg
A0A2K5V8J3_BBC3-03      tgctggcgga----gcagcacctggagtcgcccgtgc-----ccagcgcc
A0A2K5VLE9_BMF-01       tgccccctca----gccg-acttcagctcttccctct-----cacccact
A0A2K5VLE9_BMF-02       tgccccctca----gccg-acttcagctcttccctct-----cacccact
A0A2K5X1Y3_BCL2L11      agacagagcc----acaaggt-----aatcccgaagg-----caatcacg
A0A2K5X1Y3_BCL2L11      agacagagcc----acaaggt-----aatcccgaagg-----caatcacg
A0A2K5VCA9_BAD-03       aagcatcatc----gccaggccccaggcctcctgtgggacgccagtcacc
A0A2K5VCA9_BAD-02       aagcatcatc----gccaggccccaggcctcctgtgggacgccagtcacc
Q2PG01_BAD-01           cagca-cagc----gttatggccgcgagctccggagg-------------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      atttgggattgggat-gcagctgcattacaccagaggcaaaaagctcgtc
A0A2K5VW94_BIK-01       acagtgacatgttggccctgcggctggcctgcatcggggacgagatggat
A0A2K5V8J3_BBC3-03      ccgggggcc--ctgg-cgggcggtc--ccacccaggcgg-----------
A0A2K5VLE9_BMF-01       gctgtggcc--ctgg-ccttcgacccaccagccaggaag-----------
A0A2K5VLE9_BMF-02       gctgtggcc--ctgg-ccttcgacccaccagccaggaag-----------
A0A2K5X1Y3_BCL2L11      gaggtgaaggg-------gacagct-gcccccacggcag-----------
A0A2K5X1Y3_BCL2L11      gaggtgaaggg-------gacagct-gcccccacggcag-----------
A0A2K5VCA9_BAD-03       agcaggagcagccaa-ccagcagca-gccatcatggagggagagcttggt
A0A2K5VCA9_BAD-02       agcaggagcagccaa-ccagcagca-gccatcatggaggga---------
Q2PG01_BAD-01           ---atgagtgacgag-tttgtggac-tccttta---agggg---------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      tcctcctccccacttgtcctt-----------------------------
A0A2K5VW94_BIK-01       gtgag---cctcagggccccg-----------------------------
A0A2K5V8J3_BBC3-03      --------ccccgggagtccgcggggaggaggaa----------------
A0A2K5VLE9_BMF-01       --------acaaggccaccc-----------aga----------------
A0A2K5VLE9_BMF-02       --------acaaggccaccc-----------aga----------------
A0A2K5X1Y3_BCL2L11      --------ccctcagggcccgctggccccaccggcca-------------
A0A2K5X1Y3_BCL2L11      --------ccctcagggcccgctggccccaccggcca-------------
A0A2K5VCA9_BAD-03       attctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatg
A0A2K5VCA9_BAD-02       ------cttcctcg---cccgaaga-------------------------
Q2PG01_BAD-01           ------cttcctcg---cccgaaga-------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      -ccgcggggccacgaggaacaagtgcaagt--------------------
A0A2K5VW94_BIK-01       -cgcctggcccag------ctctctgaggt----------------ggcc
A0A2K5V8J3_BBC3-03      -cagtgggcccgggagatcggggcccagct--------------------
A0A2K5VLE9_BMF-01       -ccctcggcccag-----cctcccccagcc--------------------
A0A2K5VLE9_BMF-02       -ccctcggcccag-----cctcccccagcc--------------------
A0A2K5X1Y3_BCL2L11      -gccctggccctt-----ttgctaccagatccccgcttttcatctttatg
A0A2K5X1Y3_BCL2L11      -gccctggccctt-----ttgctaccagatccccgcttttcatctttatg
A0A2K5VCA9_BAD-03       ctcgcggaagcat-----cagca--cggatgtctgccccagccactgact
A0A2K5VCA9_BAD-02       -gcgcgggcacag-----cgacg--cagat--------------------
Q2PG01_BAD-01           -gcgcgggcacag-----cgacg--cagat--------------------
                                                                          

A0A2K5VPX2_PMAIP1-      ------------------------------agctcg--------------
A0A2K5VPX2_PMAIP1-      ------------------------------agctcg--------------
A0A2K5VW94_BIK-01       atgcacagcctgggtctggctttcatctacgaccagat------------
A0A2K5V8J3_BBC3-03      ----gcggcg----gatggcggacgacctcaac-----------------
A0A2K5VLE9_BMF-01       ----aaggtgtcatgctgccctgtggggtaact-----------------
A0A2K5VLE9_BMF-02       ----aaggtgtcatgctgccctgtggggtaact-----------------
A0A2K5X1Y3_BCL2L11      agaagatcctccctgctgtctcgatcctccagt-----------------
A0A2K5X1Y3_BCL2L11      agaagatcctccctgctgtctcgatcctccagt-----------------
A0A2K5VCA9_BAD-03       cagaagcccaacacgcag---agaatgtaaagctgaaggcgctggggctg
A0A2K5VCA9_BAD-02       --------------gcgg---caaagctccagctggacgc----------
Q2PG01_BAD-01           --------------gcgg---caaagctccagctggacgc----------
                                                                          

A0A2K5VPX2_PMAIP1-      ----------aagtcgagtgtgctactcaactcaggagattt--------
A0A2K5VPX2_PMAIP1-      ----------aagtcgagtgtgctactcaactcaggagattt--------
A0A2K5VW94_BIK-01       ----------ggacgacatcagggatgttcttagaagtttcatggatggt
A0A2K5V8J3_BBC3-03      ----------gcgcaatacgagcggc------------------------
A0A2K5VLE9_BMF-01       ----------gaggaaccccagcgactcttttacg---------------
A0A2K5VLE9_BMF-02       ----------gaggaaccccagcgactcttttacggcaatgctggctacc
A0A2K5X1Y3_BCL2L11      ----------gggta-------tttctcttttg-----------------
A0A2K5X1Y3_BCL2L11      ----------gggta-------tttctcttttg-----------------
A0A2K5VCA9_BAD-03       tggagacccggagtcgccacagctcctaccccgcggggacggagg-----
A0A2K5VCA9_BAD-02       ----------gagtc-------ttccagtcctggtgggatcg--------
Q2PG01_BAD-01           ----------gagtc-------ttccagtcctggtgggatcg--------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       ttcaccaccctt--------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       ggcttcctctccctgccagtttcccggcagtcttgcccatcggggagcag
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
A0A2K5VLE9_BMF-01       --------------------------------------------------
A0A2K5VLE9_BMF-02       ccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaaa
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5VCA9_BAD-03       --------------------------------------------------
A0A2K5VCA9_BAD-02       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------ggagacaaactg
A0A2K5VPX2_PMAIP1-      --------------------------------------ggagacaaactg
A0A2K5VW94_BIK-01       --------------------------------------agggagaacata
A0A2K5V8J3_BBC3-03      --------------------------------------ggagacaagagg
A0A2K5VLE9_BMF-01       ----------------------------------------------cacc
A0A2K5VLE9_BMF-02       gcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacacc
A0A2K5X1Y3_BCL2L11      ---------------------------------------------acaca
A0A2K5X1Y3_BCL2L11      ---------------------------------------------acaca
A0A2K5VCA9_BAD-03       --------------------------------------aggacgaaggga
A0A2K5VCA9_BAD-02       -------------------------------------------gaacttg
Q2PG01_BAD-01           -------------------------------------------gaacttg
                                                                          

A0A2K5VPX2_PMAIP1-      aacttccggcagaaacttctgaatctga----------------------
A0A2K5VPX2_PMAIP1-      aacttccggcagaaacttctgaatctga----------------------
A0A2K5VW94_BIK-01       atgaggttctggagatccccgaatcccagg--------------------
A0A2K5V8J3_BBC3-03      agcag-----cagcgacaccgcccctcgccctggaggg------------
A0A2K5VLE9_BMF-01       agcag-----aaccgaaatcgcgtgtgg---tggcaga------------
A0A2K5VLE9_BMF-02       agcag-----aaccgaaatcgcgtgtgg---tggcaga------------
A0A2K5X1Y3_BCL2L11      gacag-----g---agcccagcacccatgagttgtgacaaatcaacacaa
A0A2K5X1Y3_BCL2L11      gacag-----g---agcccagcacccatgagttgtgacaaatcaacacaa
A0A2K5VCA9_BAD-03       tggag-----gaggagcccagc-ccc------------------------
A0A2K5VCA9_BAD-02       ggcag-----gggaagctccgcaccc------------------------
Q2PG01_BAD-01           ggcag-----gggaagctccgcaccc------------------------
                                            *                             

A0A2K5VPX2_PMAIP1-      tagccaaactcttctgctcaggaac-------------------------
A0A2K5VPX2_PMAIP1-      tagccaaactcttctgctcaggaac-------------------------
A0A2K5VW94_BIK-01       tcctgggtgtcccgtgaacaggtgctgctggtgctgctgctgctgctggc
A0A2K5V8J3_BBC3-03      tcctgtacaatctcatcatgggact-------------------------
A0A2K5VLE9_BMF-01       tcct------cctcttcctgcacaa-------------------------
A0A2K5VLE9_BMF-02       tcct------cctcttcctgcacaa-------------------------
A0A2K5X1Y3_BCL2L11      accccaagtcctccttgccaggccttcaaccactatctcagtgcaatggg
A0A2K5X1Y3_BCL2L11      accccaagtcctccttgccaggccttcaaccactatctcagtgcaatggc
A0A2K5VCA9_BAD-03       tttcggggccgctcgcgctccgcgc-------------------------
A0A2K5VCA9_BAD-02       tcccagtgaccttcgctccacgcccggaaactccacccgctctcactgtc
Q2PG01_BAD-01           tcccagtga-----------------------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      -------------------------------------------ctga---
A0A2K5VPX2_PMAIP1-      -------------------------------------------ctgactg
A0A2K5VW94_BIK-01       ----------------------------------------------actg
A0A2K5V8J3_BBC3-03      ----------------------------------------------cctg
A0A2K5VLE9_BMF-01       ----------------------------------------------cctt
A0A2K5VLE9_BMF-02       ----------------------------------------------cctt
A0A2K5X1Y3_BCL2L11      t-------------------------------------------------
A0A2K5X1Y3_BCL2L11      ttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcg
A0A2K5VCA9_BAD-03       -------------------------------------------------c
A0A2K5VCA9_BAD-02       c--------------tggtcggccatcttggatatgggcggaagtgcttc
Q2PG01_BAD-01           --------------------------------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      catcaaaaacttgcataaggggactccaaaagagactttttctcaggagg
A0A2K5VW94_BIK-01       ctgctggcgctgctcagcgggggcctgcacctgctgct------------
A0A2K5V8J3_BBC3-03      cccttacccaggggccacagagcccccgaaatggagcc------------
A0A2K5VLE9_BMF-01       gctttgaatggagaagagaacaggaacggggcgggccc------------
A0A2K5VLE9_BMF-02       gctttgaatggagaagagaacaggaacggggcgggccc------------
A0A2K5X1Y3_BCL2L11      ---------------------------atttt------------------
A0A2K5X1Y3_BCL2L11      cccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaagg
A0A2K5VCA9_BAD-03       ccccaacctctgggcagcacagcgttatggccgcgagctccggaggatga
A0A2K5VCA9_BAD-02       cctcaggccttatgcaaaagaggatccgtgctgcctctttcggtgggagg
Q2PG01_BAD-01           --------------------------------------------------
                                                                          

A0A2K5VPX2_PMAIP1-      ------------------------------------------
A0A2K5VPX2_PMAIP1-      tgcacacttcatcaatttgaagaaagattgcattgtaattgg
A0A2K5VW94_BIK-01       ------------------------caagtga-----------
A0A2K5V8J3_BBC3-03      ------------------------caattag-----------
A0A2K5VLE9_BMF-01       ------------------------tag---------------
A0A2K5VLE9_BMF-02       ------------------------taggtga-----------
A0A2K5X1Y3_BCL2L11      ------------------------tgaataa-----------
A0A2K5X1Y3_BCL2L11      -------aggatgtcgcttccacctgattaa-----------
A0A2K5VCA9_BAD-03       ------------------------------------------
A0A2K5VCA9_BAD-02       gctgacccagattcccttccggtgcatgtga-----------
Q2PG01_BAD-01           ------------------------------------------
                                                                  

© 1998-2020Legal notice