Dataset for CDS BCL2L11 of organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgagtggttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaattggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=879 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctcagggcccgctggcccca
ccggccagccctggcccttttgctaccagatccccgcttttcatctttatgagaagatcctccctgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagata
cggatcgcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
agcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5X1Y3_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtgcggaaccctcggctgcccggcggagtgcgg
cggcgggctggcgggaaggcgcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgtttcctgcgct
gccttcgtggtgacggtcagggggcgccgggtcggcgaagagcgcgggccagacgccccggggcccgggcgcgggcccgg
acgctacgctctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttctgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagaggcctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccaggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcg
gcgaattggagacgagtttaacgcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccac
aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcattga
© 1998-2021Legal notice