Dataset for CDS BCL2L11 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      atgttcccggcggctgcggccggggcagcgcgggccagaggcgcggcgtg
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggaaccctcggctgcccggcggagtgcggcggcgggctggcgggaaggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cggaaccctcggctgcccggcggagtgcggcggcgggctggcgggaaggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      gcgggctgtgcgctgcgccgggtactctgaacccaagtccagagctttgt
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ttcctgcgctgccttcgtggtgacggtcagggggcgccgggtcggcgaag
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      agcgcgggccagacgccccggggcccgggcgcgggcccggacgctacgct
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      ctgaagggaaggcgcggacaaaaaaagaccaaatggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
A0A2K5X1Y3_BCL2L11      --------------------------------atggcaaagcaaccttct
                                                        ******************

A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2K5X1Y3_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
                        **************************************************

A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
A0A2K5X1Y3_BCL2L11      gaggcctccccagctcagacctggggcccctacctccctacagacagagc
                        **************************************************

A0A2K5X1Y3_BCL2L11      cacaa---------------------------------------------
A0A2K5X1Y3_BCL2L11      cacaa---------------------------------------------
A0A2K5X1Y3_BCL2L11      cacaa---------------------------------------------
A0A2K5X1Y3_BCL2L11      caca----------------------------------------------
A0A2K5X1Y3_BCL2L11      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
A0A2K5X1Y3_BCL2L11      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
A0A2K5X1Y3_BCL2L11      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
A0A2K5X1Y3_BCL2L11      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcccc
                        ****                                              

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
A0A2K5X1Y3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
A0A2K5X1Y3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
A0A2K5X1Y3_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccctggcccttt
                                                                          

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K5X1Y3_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K5X1Y3_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
A0A2K5X1Y3_BCL2L11      tgctaccagatccccgcttttcatctttatgagaagatcctccctgctgt
                                                                          

A0A2K5X1Y3_BCL2L11      -----------------------------------gacaggagcccagca
A0A2K5X1Y3_BCL2L11      -----------------------------------gacaggagcccagca
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ----------------------------------agacaggagcccagca
A0A2K5X1Y3_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K5X1Y3_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K5X1Y3_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2K5X1Y3_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
                                                                          

A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2K5X1Y3_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                                                                          

A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtg
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg---------atgag----------
A0A2K5X1Y3_BCL2L11      -------------------------g----cttccaggag----------
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg----cttccaggag----------
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg----cttccaggag----------
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg----cttccaggag----------
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg----cttccaggag----------
A0A2K5X1Y3_BCL2L11      cttcaaccactatctcagtgcaatgg----cttccaggag----------
                                                 *           ***          

A0A2K5X1Y3_BCL2L11      atagttcattgtggtttggatttatatttactggcttaga--tttgtatg
A0A2K5X1Y3_BCL2L11      ----------gccactggatcct---------ccctcgga-------att
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
A0A2K5X1Y3_BCL2L11      ----------gcaggctgaacctgcagatatgcgcccggagatacggatc
                                  *      *    *           *   **       ** 

A0A2K5X1Y3_BCL2L11      gccacc------------accacagtcaagatacagaacaactcaaccac
A0A2K5X1Y3_BCL2L11      gccc--------------ttcatagggaagttcagtggccgct----cga
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
A0A2K5X1Y3_BCL2L11      gcccaagagttgcggcgaattggagacgagtttaacgcttactatgcaag
                        ***                    **   ** *         **       

A0A2K5X1Y3_BCL2L11      aaggat--------------------------------------------
A0A2K5X1Y3_BCL2L11      gtggtta-------------------------------------------
A0A2K5X1Y3_BCL2L11      gaggttg------------------------gcagaactcc---------
A0A2K5X1Y3_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccacccacaaatgg
A0A2K5X1Y3_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccacccacaaatgg
A0A2K5X1Y3_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccacccacaaatgg
A0A2K5X1Y3_BCL2L11      gaggatgtcgct--------------------------------------
A0A2K5X1Y3_BCL2L11      gaggttagag----------------------------------------
                          ** *                                            

A0A2K5X1Y3_BCL2L11      ---------------------------ttctcatga--------------
A0A2K5X1Y3_BCL2L11      ------------------------gcatcaagctaa--------------
A0A2K5X1Y3_BCL2L11      -------------------tggcatcctccacctga--------------
A0A2K5X1Y3_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5X1Y3_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5X1Y3_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5X1Y3_BCL2L11      ---------------------------tccacctg-------------at
A0A2K5X1Y3_BCL2L11      ----------------------------------a-------------aa
                                                                          

A0A2K5X1Y3_BCL2L11      ---
A0A2K5X1Y3_BCL2L11      ---
A0A2K5X1Y3_BCL2L11      ---
A0A2K5X1Y3_BCL2L11      tga
A0A2K5X1Y3_BCL2L11      tga
A0A2K5X1Y3_BCL2L11      tga
A0A2K5X1Y3_BCL2L11      taa
A0A2K5X1Y3_BCL2L11      tag
                           

© 1998-2022Legal notice