Dataset for CDS BCL2L11 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5X1Y3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5X1Y3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5X1Y3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5X1Y3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K5X1Y3_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5X1Y3_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **************************************************

A0A2K5X1Y3_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5X1Y3_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A2K5X1Y3_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5X1Y3_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                        **************************************************

A0A2K5X1Y3_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5X1Y3_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A2K5X1Y3_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5X1Y3_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A2K5X1Y3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggt----
A0A2K5X1Y3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        ******************************************** *    

A0A2K5X1Y3_BCL2L11      --------------------------------------------------
A0A2K5X1Y3_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
                                                                          

A0A2K5X1Y3_BCL2L11      ----------------------atttt-----------------------
A0A2K5X1Y3_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggat
                                              * ***                       

A0A2K5X1Y3_BCL2L11      ------------tgaataa
A0A2K5X1Y3_BCL2L11      gtcgcttccacctgattaa
                                    *** ***

© 1998-2020Legal notice