Dataset for CDS classical BH3-containing proteins of organism Lynx canadensis

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A667G4D3_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Lynx canadensis GN=BIK (length=447 residues).
atgtctcacgcaggacccctctccaggaacgtctttttgagcaccttcctgcaggagcatggcccggaagttctggacgt
tcctggcatgaccgatctcgtggagtactatgatcctgggccctcccctaacagcaacagccccgacgatgtggccatgc
ggctggccttcatcggggacgagatggaggggcggtggatgatgccccgcgttggcgagctgcccgggatggccgtgtac
agcttggccttcacctacaaccagacgggcctgagaggtgttctcagaagtctcatggatggtctggccaacctcaggga
gaacatacggatctggggcttcctgaccctcaggaacagggtgtcccccaactcggggcgcgggctggcgctgtccctgc
tgctgctggtgttgctgctgggctgggggctccacctcctccagtga
>gnl|bcl2dbcds|A0A667H8Z9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lynx canadensis GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagcgagcaggaagactcgagccctacggataggggcctgggccccagccccac
aggggaccggccccgcggccctggcaagcaccagcggacggccccaggcctcctcggggaagctggtcaccagcaggggc
agcccgccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggacc
gaggaggatgaagggacggaggaggaagagcctagccctttccggggtcgctcgcgctcagcgccccccaacctctgggc
tgccctgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A667H967_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Lynx canadensis GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A667H9R7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A667H9R7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagaccgagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A667H9R7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|A0A667H9R7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgcttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A667H9R7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagaccgagcagcaagcttccatgaggcagcctcaggctgtacccgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaaggaggctggca
agagtaccggcatcctacatctga
>gnl|bcl2dbcds|A0A667HYB7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Lynx canadensis GN=PMAIP1 (length=372 residues).
gaggagagcgcgggagccggccggcgatcagacctgagaggtgcgcgcgcgagcctgtcgtcgctggtagagttgggtcc
cgccgccccggtccggcccgtccccccccgcgcgtgcagctcgcgtgccgccgccccgaggtgttcggggtgggggaccg
agaaccccgggctcctgcggcacggtggccggcggccgctggcggagatgcctgggaagaggacgcgtaagagcgcgcag
ccgagccccgcgcgggccccggcagagcccgaagtggaatgtgccatgcagctccggagatttggagacaaactgaattt
ccgacagaagcttatgaatctgatatccaaactcttccgctcgggaacctga
>gnl|bcl2dbcds|A0A667IM83_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Lynx canadensis GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgcccctttcccct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggtccgcgccccgacggtcctcagccctcactctcgccggcagagcagcacctggaatcgcc
ggtgcccagcgccccgggggccctggcgggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcacgggactcctgcccttacccagggcccgcggggc
cccggaggtggagcccaattag
© 1998-2020Legal notice