Dataset for CDS classical BH3-containing proteins of organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667G4D3_BIK-01       atgtctcac---------------------------------gcaggacc
A0A667H8Z9_BAD-01       atgttccagatccc----------------------------agag----
A0A667HYB7_PMAIP1-      -------------------------------------------gagg---
A0A667IM83_BBC3-01      atggcccgagcacg----------------------------ccagg---
A0A667H967_BMF-01       atgg---agccgcc-------------tcagtgtgtggaggagctgg---
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaagg---
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaagg---
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaagg---
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaagg---
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaagg---

A0A667G4D3_BIK-01       cctctccaggaacgtctttttgagcaccttcctgcaggagcatggccc--
A0A667H8Z9_BAD-01       ------------------tttgag------cccagcgag---------ca
A0A667HYB7_PMAIP1-      -------agagcg-----cgggag------ccggccggcgatcagacctg
A0A667IM83_BBC3-01      -------agggcagctccccggag------cccgtagagggcctggcccg
A0A667H967_BMF-01       -------aggatgatgtgttccag------ccagaggat-----------
A0A667H9R7_BCL2L11      -------tggacaa----ttgcag------cctgctgag-----------
A0A667H9R7_BCL2L11      -------tggacaa----ttgcag------cctgctgag-----------
A0A667H9R7_BCL2L11      -------tggacaa----ttgcag------cctgctgag-----------
A0A667H9R7_BCL2L11      -------tggacaa----ttgcag------cctgctgag-----------
A0A667H9R7_BCL2L11      -------tggacaa----ttgcag------cctgctgag-----------
                                              **      **    *             

A0A667G4D3_BIK-01       ggaagttctggacgt--------------tcctggcatgaccgatctcgt
A0A667H8Z9_BAD-01       ggaagactcgagccc---tacggataggggcctg--ggccccagccccac
A0A667HYB7_PMAIP1-      aga-ggtgcgcgcgc------------gagcctgtcgtcgctggtagagt
A0A667IM83_BBC3-01      cgacggcccgcgcccctttcccctcagccgcctggtgccctcggccgtgt
A0A667H967_BMF-01       ggggagccggggacc------------cagcctggga--gcttgctgtct
A0A667H9R7_BCL2L11      aggcctcctcagctc------------aggcctggggcccctacctctct
A0A667H9R7_BCL2L11      aggcctcctcagctc------------aggcctggggcccctacctctct
A0A667H9R7_BCL2L11      aggcctcctcagctc------------aggcctggggcccctacctctct
A0A667H9R7_BCL2L11      aggcctcctcagctc------------aggcctggggcccctacctctct
A0A667H9R7_BCL2L11      aggcctcctcagctc------------aggcctggggcccctacctctct
                         *                            ****                

A0A667G4D3_BIK-01       ggagtactatgatc------------------------------------
A0A667H8Z9_BAD-01       aggg------------------------g---------------------
A0A667HYB7_PMAIP1-      tggg----------------------------------------------
A0A667IM83_BBC3-01      cctgcggcctctgcgagcccggcctgccc---------------------
A0A667H967_BMF-01       gctaacctgtttgc------------------------------------
A0A667H9R7_BCL2L11      acagaccgagcagcaag---------------------------------
A0A667H9R7_BCL2L11      acagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgccccc
A0A667H9R7_BCL2L11      acagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgccccc
A0A667H9R7_BCL2L11      acagaccgagcagcaaggtaatcctgaaggcgaaggggaccgctgccccc
A0A667H9R7_BCL2L11      acagaccgagcagca-----------------------------------

A0A667G4D3_BIK-01       -----------ctgggccc----------------tcccctaacagcaac
A0A667H8Z9_BAD-01       ----------accggccccgcggccctggcaagcaccagcggacggcccc
A0A667HYB7_PMAIP1-      ---------------tcccgccgccccggt-----ccggc------ccgt
A0A667IM83_BBC3-01      ----------gccgcccccgccgcccccgc-----cctgctgcccgccgc
A0A667H967_BMF-01       ----------ccagagccagctggactgcc-----ccctcagccatctgc
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      aaggcagccctcagggcccgctg----gcc-----ccaccagccagcccc
A0A667H9R7_BCL2L11      aaggcagccctcagggcccgctg----gcc-----ccaccagccagcccc
A0A667H9R7_BCL2L11      aaggcagccctcagggcccgctg----gcc-----ccaccagccagcccc
A0A667H9R7_BCL2L11      --------------------------------------------------

A0A667G4D3_BIK-01       agccccgac-----------------------------------------
A0A667H8Z9_BAD-01       aggcctcct--------------------------cggggaagctggtca
A0A667HYB7_PMAIP1-      ccccccccg--------------------------c----------g---
A0A667IM83_BBC3-01      ctacctctg--------------------------c----------gccc
A0A667H967_BMF-01       agctcttcc-----------------------------------ctctca
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      gggccttttgctaccagatccccgcttttcatctttgtcagaagatcctc
A0A667H9R7_BCL2L11      gggccttttgctaccagatccccgcttttcatctttgtcagaagatcctc
A0A667H9R7_BCL2L11      gggccttttgctaccagatccccgcttttcatctttgtcagaagatcctc
A0A667H9R7_BCL2L11      --------------------------------------------------

A0A667G4D3_BIK-01       ------gatgtggccat--------------------------gcggctg
A0A667H8Z9_BAD-01       ccagcaggggcagccc---------------------------gccagca
A0A667HYB7_PMAIP1-      ----c--gtgcagctc---------------------------gc--gtg
A0A667IM83_BBC3-01      ccacc--gccccgccc---------------------------gccgtca
A0A667H967_BMF-01       cccactgctgtggtcct-------------------------gggcttcg
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      cctgctgtctcgatcctccagtgggtatttctcttttgacacagacagga
A0A667H9R7_BCL2L11      cctgctgtctcgatcctccagtgggtatttctcttttgacacagacagga
A0A667H9R7_BCL2L11      cctgctgtctcgatcctccagtgggtatttctcttttgacacagacagga
A0A667H9R7_BCL2L11      ------------------------------------------agacagga

A0A667G4D3_BIK-01       gccttcatcggggacgagatggaggggcggtgga----------------
A0A667H8Z9_BAD-01       gcaaccaccatggaggcgc---tggggctgtggagacccggagtcgccac
A0A667HYB7_PMAIP1-      ccgccgccccgaggtgttc-----ggggtgggggaccgagaa-----ccc
A0A667IM83_BBC3-01      ccgccgccctggggggcccccgctggcctgggggtccccgcagccggccc
A0A667H967_BMF-01       acccaccagccaggaa----gacaaggccacccagaccctcagtccggcc
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      gcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcct
A0A667H9R7_BCL2L11      gcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcct
A0A667H9R7_BCL2L11      gcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcct
A0A667H9R7_BCL2L11      gcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcct

A0A667G4D3_BIK-01       tgatgccccgcgtt-----------------------------ggcgagc
A0A667H8Z9_BAD-01       ag----ctcgtaccccgccgg-----------------gaccgaggagga
A0A667HYB7_PMAIP1-      cgggctcctgcggcacggtggccggcggc---------cgctggcggaga
A0A667IM83_BBC3-01      cgaggtcc-gcgccccgacggtcctcagccctcactctcgccggcagagc
A0A667H967_BMF-01       tc----cccgagtcagggtgtcatgctgccttgtggggtgaccgaagaac
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      tg----cc-------------------------------------aggcc
A0A667H9R7_BCL2L11      tg----cc-------------------------------------aggcc
A0A667H9R7_BCL2L11      tg----cc-------------------------------------aggcc
A0A667H9R7_BCL2L11      tg----cc-------------------------------------aggcc

A0A667G4D3_BIK-01       tgcccgggatggccgtgtacag---------------------cttggcc
A0A667H8Z9_BAD-01       tgaagggacggagga---ggaa---gagc--------------ctagccc
A0A667HYB7_PMAIP1-      tgcctgggaagaggacgcgtaa---gagcg-------cgcagccgagccc
A0A667IM83_BBC3-01      agc-----------acctggaa---tcgc--------cggtgcccagcgc
A0A667H967_BMF-01       cccagcgactcttttatggcaacgctggctacc----ggctccctctccc
A0A667H9R7_BCL2L11      ----------------------------cttccatgaggcagcctcaggc
A0A667H9R7_BCL2L11      ttcaaccattatctcagtgcaa---tggcttccatgaggcagcctcaggc
A0A667H9R7_BCL2L11      ttcaaccattatctcagtgcaa---t------------------------
A0A667H9R7_BCL2L11      ttcaaccattatctcagtgcaa---tggcttccatgaggcagcctcaggc
A0A667H9R7_BCL2L11      ttcaaccattatctcagtgcaa---tggcttccatgaggcagcctcaggc

A0A667G4D3_BIK-01       ttcacctacaaccagacgggcct---------------------------
A0A667H8Z9_BAD-01       tttccggggtcgctcgcgctcagcgccc------------ccc----aac
A0A667HYB7_PMAIP1-      --cgcgcgggccccggcag----------------------------agc
A0A667IM83_BBC3-01      --cccgggggccctggcgggcggcccca------------cccaggcagc
A0A667H967_BMF-01       --tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A667H9R7_BCL2L11      --tg------tacccgcagatatgcgcc----------------------
A0A667H9R7_BCL2L11      --tg------tacccgcagatatgcgcc----------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --tg------tacccgcagatatgcgcc----------------------
A0A667H9R7_BCL2L11      --tg------tacccgcagatatgcgcc----------------------

A0A667G4D3_BIK-01       ----------------------gagaggtgttctcag------------a
A0A667H8Z9_BAD-01       ctctgggct----------------------gccctgcgctacggccgcg
A0A667HYB7_PMAIP1-      cc-----------------gaagtggaatgtgccatg------------c
A0A667IM83_BBC3-01      cccgggagtccggggggaggaggagcagtgggcccgggagatcggggccc
A0A667H967_BMF-01       gcattggcagcatcgagcagaggtacagattgcccga------------a
A0A667H9R7_BCL2L11      -----------------cggagatatggattgcacaa------------g
A0A667H9R7_BCL2L11      -----------------cggagatatggattgcacaa------------g
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      -----------------cggagatatggattgcacaa------------g
A0A667H9R7_BCL2L11      -----------------cggagatatggattgcacaa------------g

A0A667G4D3_BIK-01       agtctcatggatggtctggccaacctcagggagaacatacggatctgggg
A0A667H8Z9_BAD-01       agctccggaggatgagcgacgagttccag--ggctccttcaag----gga
A0A667HYB7_PMAIP1-      agctccggagatt---------------------------------tgga
A0A667IM83_BBC3-01      agctgcggcggatggcggacgacctcaac--gcgctgtacgagcggcgga
A0A667H967_BMF-01       agcttcagtgcattgcagaccagttccatcggcttcatatgcagcaaca-
A0A667H9R7_BCL2L11      agttgcggcgtatcggagacgaatttaat--gcatattacccaaggagg-
A0A667H9R7_BCL2L11      agttgcggcgtatcggagacgaatttaat--gcatattacccaaggagg-
A0A667H9R7_BCL2L11      -----------------------------------------------ggg
A0A667H9R7_BCL2L11      agttgcggcgtatcggagacgaatttaat--gcatattacccaaggaggg
A0A667H9R7_BCL2L11      agttgcggcgtatcggagacgaatttaat--gcatattacccaaggaggg

A0A667G4D3_BIK-01       cttcct-----gaccctcaggaacagggtgtcccccaactc---------
A0A667H8Z9_BAD-01       cttccacgcccgaagagcg-------cgggcacagcgac-----------
A0A667HYB7_PMAIP1-      -----------gacaaact-------gaatttc--cgaca----------
A0A667IM83_BBC3-01      -----------gacaagag-------gagcagcagcgacaccgcccctca
A0A667H967_BMF-01       ----ccagcaaaaccgccg-------------------------------
A0A667H9R7_BCL2L11      ----ctggcaagagtaccg-------------------------------
A0A667H9R7_BCL2L11      ----ttagagcaatag----------------------------------
A0A667H9R7_BCL2L11      tctttttgaataa-------------------------------------
A0A667H9R7_BCL2L11      tctttttgaataattaccaagcagccgaagcccagccccaaatgattatc
A0A667H9R7_BCL2L11      tctttttgaataattaccaagcagccgaagcccagccccaaatgattatc

A0A667G4D3_BIK-01       -----ggggcgcgggctggcgctgtccctgctgctgctggtgttgctgct
A0A667H8Z9_BAD-01       -----gcagatgcggcaaagccccagctggacgcgcttcatccagtcctg
A0A667HYB7_PMAIP1-      -----gaagcttatg---aatctgatatccaaactcttccgct-------
A0A667IM83_BBC3-01      ccctggagggtcctgtacaatctcatcacgggactcctgcccttacccag
A0A667H967_BMF-01       --tcgagtgtggtggcagattctcctcttcctacacaacctggctttgaa
A0A667H9R7_BCL2L11      ----------------gcatcctacatctga-------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      ttacgactgttacgttacatcgtccgcctggtatggcgattg--------
A0A667H9R7_BCL2L11      ttacgactgttacgttacatcgtccgcctggtatggcgattg--------

A0A667G4D3_BIK-01       gggctgggggctcc------------------acctcctccagtga
A0A667H8Z9_BAD-01       gtgggatcggaacttggggagaggaggctccgccccctcccagtga
A0A667HYB7_PMAIP1-      ------cgggaacctga-----------------------------
A0A667IM83_BBC3-01      ggcccgcggggccccggaggtggag------------cccaattag
A0A667H967_BMF-01       tgcagaagagaacaggaatggggcaggt---------cccaggtga
A0A667H9R7_BCL2L11      ----------------------------------------------
A0A667H9R7_BCL2L11      ----------------------------------------------
A0A667H9R7_BCL2L11      ----------------------------------------------
A0A667H9R7_BCL2L11      ----------------------------------------cagtga
A0A667H9R7_BCL2L11      ----------------------------------------cagtga

© 1998-2021Legal notice