Dataset for CDS classical BH3-containing proteins of organism Laticauda laticaudata

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C5RCV4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Laticauda laticaudata GN=BAD (length=234 residues).
atggaggaagtgggggctttccgggcccgctcacgctctgcccctcccattttgtgggccgcgcaacgatacggccgaga
attacgcaggatgagcgatgaatttcacggcctgccgcgcccgaaaagtgccgggacctgctcccacatggaccgccctc
ctcccagctggaaggacaccctgcggtcgtggtggcgccgaagttgcccggagaatggaccttccagttcttaa
>gnl|bcl2dbcds|A0A8C5RIV9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Laticauda laticaudata GN=PMAIP1 (length=159 residues).
atgattgtttcatcaatgcaaattggcaataccgtgcttgtctgttttacagagtgctctgtcgccatagctttgcagct
acgcagaattggggataaatggaatctccggcaaagaattctgaaccttttctccaagctcttctgcccaggaacttga
>gnl|bcl2dbcds|A0A8C5ST95_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Laticauda laticaudata GN=BMF (length=585 residues).
atggatcctcctgttttcctggaagatgatttttcccatttggatgggttagatgatgatgtattccactctgacgactg
tgaactggtcagtcagtccagcaagatggcttttcgtggcattttcactcaaagcaaatcttacaactgcctcctgggca
ggttccagctcttcccacttacgcactgttgtggcccaggcagcaggcatgccaaacaacaggacaaggcaacacagacc
ctcaatgcatcctcttccagccaggatatcatgttaccttgtggagtcactgaagagcctcagagactcttttatggaaa
tgctggataccgtttacatgtccaaccaatcggtttcacattgaatccacatctccaggaggaacctcaggaaagtctgc
aggaattgcgtaccgaagttcagattgcacggaaattacagtgcattgcagatcagttccacaggcttcatctgcagagg
atacttaaaagccactgtggggacttttgcttccctttattccacccattggttaccagattcttttgccatctggaata
tattcatccatctgttactctgggg
>gnl|bcl2dbcds|A0A8C5STS5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL2L11 (length=609 residues).
atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtggacaattgcagcctgctgaaaggccagctca
gcctcatcaccttcggcctggggcccctacctccttacaaactgaatatcaaggtaatcatttgggtgaacgggacagtt
catcacccggtagccctcagggaccactggcaccaccctccagtcccagtccatttgcaaccagatccccgttgttcatg
tttgtaagaagatccccactgctgtccagatcctccagtgggtatttctcttttgacatcgacaggagtcctgcacctat
gaattgtgacaaagcaacacagactccaagtccgccctgtcaagctatcaatcattatctaagtgcaatgggtaagcaag
agcatgcttccagatggcagtcacggcctatacctgaggatatgcagccagaaatatggattgcacaggaattacggcgt
attggagatgaatttaatgcttcctactgtccaagaaggggtttattggattaccagggagtaaatcaccagatcataat
tttgcgccttttgcattatatcgtccgcttcatatggagaatgcagtga
>gnl|bcl2dbcds|A0A8C5STS5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL2L11 (length=642 residues).
atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtggacaattgcagcctgctgaaaggccagctca
gcctcatcaccttcggcctggggcccctacctccttacaaactgaatatcaaggtaatcatttgggtgaacgggacagtt
catcacccggtagccctcagggaccactggcaccaccctccagtcccagtccatttgcaaccagatccccgttgttcatg
tttgtaagaagatccccactgctgtccagatcctccagtgggtatttctcttttgacatcgacaggagtcctgcacctat
gaattgtgacaaagcaacacagactccaagtccgccctgtcaagctatcaatcattatctaagtgcaatgggtaagcaag
agcatgcttccagatggcagtcacggcctatacctgaggatatgcagccagaaatatggattgcacaggaattacggcgt
attggagatgaatttaatgcttcctactgtccaagaagggtaactttcaacatttttattgttttaaattcttttgctta
ttccagtgatggagctctgtcgacttatacaaaggacaggggaaagcaaatgttacatctcgaacatttgctaaattact
gg
© 1998-2022Legal notice