Dataset for CDS classical BH3-containing proteins of organism Laticauda laticaudata

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5RCV4_BAD-01       atgg-------------------------------------aggaagtgg
A0A8C5RIV9_PMAIP1-      atga------------ttgtttca--------------------------
A0A8C5ST95_BMF-01       atgg------atcctcctgttt----tcctg-----------gaagatga
A0A8C5STS5_BCL2L11      atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtgg
A0A8C5STS5_BCL2L11      atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtgg
                        ***                                               

A0A8C5RCV4_BAD-01       --------------------------------------------------
A0A8C5RIV9_PMAIP1-      --------------------------------------------------
A0A8C5ST95_BMF-01       --------------------------------tttttcccatttggatgg
A0A8C5STS5_BCL2L11      acaattgcagcctgctgaaaggccagctcagcctcatcaccttcggcctg
A0A8C5STS5_BCL2L11      acaattgcagcctgctgaaaggccagctcagcctcatcaccttcggcctg
                                                                          

A0A8C5RCV4_BAD-01       --------------------------------------------------
A0A8C5RIV9_PMAIP1-      --------------------------------------------------
A0A8C5ST95_BMF-01       g-------------ttagatgatgatgtattccactctgacgact---gt
A0A8C5STS5_BCL2L11      gggcccctacctccttacaaactga---atatcaaggtaatcatttgggt
A0A8C5STS5_BCL2L11      gggcccctacctccttacaaactga---atatcaaggtaatcatttgggt
                                                                          

A0A8C5RCV4_BAD-01       -------------------------gggctttccgggcccgctcacgctc
A0A8C5RIV9_PMAIP1-      --------------------------------------------------
A0A8C5ST95_BMF-01       gaactggtcagtcagtccagcaagatggcttttcg-------tggcattt
A0A8C5STS5_BCL2L11      gaacgggacagttcatc--acccggtagccctcagggaccactggcacca
A0A8C5STS5_BCL2L11      gaacgggacagttcatc--acccggtagccctcagggaccactggcacca
                                                                          

A0A8C5RCV4_BAD-01       tgcccc--------------------------------------------
A0A8C5RIV9_PMAIP1-      ----tcaatgcaaat----tggcaat------------------------
A0A8C5ST95_BMF-01       tcactcaaagcaaatc---ttacaactgcctcctgggcaggttccagctc
A0A8C5STS5_BCL2L11      ccctccagtcccagtccatttgcaac-----------cagatccccgttg
A0A8C5STS5_BCL2L11      ccctccagtcccagtccatttgcaac-----------cagatccccgttg
                             *                                            

A0A8C5RCV4_BAD-01       -tcccattt-------------------tgtgggccgcg-----------
A0A8C5RIV9_PMAIP1-      accgtgcttgt-------------ctgtttt-------------------
A0A8C5ST95_BMF-01       ttcccactta----------cgcactgttgtggcccagg-----cagcag
A0A8C5STS5_BCL2L11      ttcatgtttgtaagaagatccccactgctgt---ccagatcctccagtgg
A0A8C5STS5_BCL2L11      ttcatgtttgtaagaagatccccactgctgt---ccagatcctccagtgg
                          *    **                   * *                   

A0A8C5RCV4_BAD-01       ------------------caacga--------------------------
A0A8C5RIV9_PMAIP1-      --------------------acag--------------------------
A0A8C5ST95_BMF-01       gcatgcc--------aaacaacag----------------------gaca
A0A8C5STS5_BCL2L11      gtatttctcttttgacatcgacaggagtcctgcacctatgaattgtgaca
A0A8C5STS5_BCL2L11      gtatttctcttttgacatcgacaggagtcctgcacctatgaattgtgaca
                                            **                            

A0A8C5RCV4_BAD-01       --------------------------------------------------
A0A8C5RIV9_PMAIP1-      --------------------------------------------------
A0A8C5ST95_BMF-01       aggcaacacagaccctcaatgcatcctcttccagccaggatatca--tgt
A0A8C5STS5_BCL2L11      aagcaacacagactccaagtccgccct------gtcaagctatcaatcat
A0A8C5STS5_BCL2L11      aagcaacacagactccaagtccgccct------gtcaagctatcaatcat
                                                                          

A0A8C5RCV4_BAD-01       --------------------------------------------------
A0A8C5RIV9_PMAIP1-      -------------------agtgct-------------------------
A0A8C5ST95_BMF-01       taccttgtggagtcactgaagagcctcagagactcttttatggaaatgct
A0A8C5STS5_BCL2L11      tatct-------------aagtgca--------------atgggtaagca
A0A8C5STS5_BCL2L11      tatct-------------aagtgca--------------atgggtaagca
                                                                          

A0A8C5RCV4_BAD-01       --------------------------------------------------
A0A8C5RIV9_PMAIP1-      ------------------------------------ctgtcgccatagct
A0A8C5ST95_BMF-01       ggataccgtttacatgtccaaccaatcggtttcacattgaatccacatct
A0A8C5STS5_BCL2L11      aga--------gcatgc------------ttccagatggcagtcacggcc
A0A8C5STS5_BCL2L11      aga--------gcatgc------------ttccagatggcagtcacggcc
                                                                          

A0A8C5RCV4_BAD-01       --------------------------------tacggc------------
A0A8C5RIV9_PMAIP1-      t-------------------------------tgcagc------------
A0A8C5ST95_BMF-01       ccaggaggaacctcaggaaagtctgcaggaattgcgtaccgaagttcaga
A0A8C5STS5_BCL2L11      t------atacctgaggata------------tgcagccagaaatatgga
A0A8C5STS5_BCL2L11      t------atacctgaggata------------tgcagccagaaatatgga
                                                        * *               

A0A8C5RCV4_BAD-01       -----cgagaattacgcaggatgagcgatgaatttcac-ggcctgccgcg
A0A8C5RIV9_PMAIP1-      ------------tacgcagaattggggataaatggaat-------ctccg
A0A8C5ST95_BMF-01       ttgcacggaaattacagtgcattgcagatcagttccacaggcttcat-ct
A0A8C5STS5_BCL2L11      ttgcacaggaattacggcgtattggagatgaatttaat--gcttcctact
A0A8C5STS5_BCL2L11      ttgcacaggaattacggcgtattggagatgaatttaat--gcttcctact
                                    ***   * **    *** * *   *           * 

A0A8C5RCV4_BAD-01       cccgaaaagtgccgggacctgctcccacatggaccgccctcctcccagct
A0A8C5RIV9_PMAIP1-      gcaaagaattctgaa------------------ccttttct---------
A0A8C5ST95_BMF-01       gcagaggatacttaaaagccactgtgg---ggacttttgcttccct----
A0A8C5STS5_BCL2L11      gtccaag------aaggg----------------gtttattggattacca
A0A8C5STS5_BCL2L11      gtccaag------aagggtaactttca---acatttttattgtttta---
                            *                                             

A0A8C5RCV4_BAD-01       ggaaggacaccctgcggtcgtggtggcgccgaagtt-----gcccggaga
A0A8C5RIV9_PMAIP1-      -----------------------------ccaagctcttctgcc--cagg
A0A8C5ST95_BMF-01       --------ttattccacccat--tggttaccagattcttttgccatctgg
A0A8C5STS5_BCL2L11      gggagtaaatcaccagatcat-----------aattttg-cgccttttgc
A0A8C5STS5_BCL2L11      ------aattcttttgcttattccagtgatggagctctgtcgacttatac
                                                           *     * *      

A0A8C5RCV4_BAD-01       a-------------tggaccttccagttcttaa-----------------
A0A8C5RIV9_PMAIP1-      a--------------------------acttga-----------------
A0A8C5ST95_BMF-01       a----atatattcatccatctgttac-tctgggg----------------
A0A8C5STS5_BCL2L11      a---------ttatatcgtccgcttcatatggagaatgcagtga------
A0A8C5STS5_BCL2L11      aaaggacaggggaaagcaaatgttacatctcgaacatttgctaaattact
                        *                            *                    

A0A8C5RCV4_BAD-01       --
A0A8C5RIV9_PMAIP1-      --
A0A8C5ST95_BMF-01       --
A0A8C5STS5_BCL2L11      --
A0A8C5STS5_BCL2L11      gg
                          

© 1998-2022Legal notice