Dataset for CDS classical BH3-containing proteins of organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A4W6DUL1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Lates calcarifer GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcagggagataaagtgcgagga
ccggggcacgcagacacctggccctgccctggcactgaacaacggcatgctgccctgtggagtcgaggaggagcccagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacactttgagctcgctgggaatcaggaagcgaggcga
caggaaagtgaagaggagcgaaacgggatggagcagctaccccagcggcagcctgtggcgcgcagtgtggaggcttgcat
tggccagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctggctgcagctctgctgagcctcctgtttgacaggggcttcatcgctggaggaggtggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A4W6EMZ7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lates calcarifer GN=BAD (length=504 residues).
atggctgcaaacttcactatttcagacagtgagtcagaggcttcggaggaggtagaggagggagaaatgaaccaatcatc
aactgagcaagagcagcagattcctcaacgcaacaccgtcaccctccctgagctcagactgccagtgcccggtcgaatca
ggctgaactcagagtcccacgcttccactgcctccagagacgaggggctccaggtaaggggggaagaggaagccgggacg
cccaccgagggagctccattccggggacggtccaagtcagctccccctgcgttgtgggcagctaagaaatacggacagaa
gctccgaaggatgagcgatgagtttgacagcctgctagacaaaggggagatgaggagggtgaagagcgctacaacgacca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggtgaaaacaaccaccacgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A4W6EMZ7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lates calcarifer GN=BAD (length=690 residues).
atgtacaggaacaaatgttgtttggtcatcatttgtatgaataacgtgcttaacgtttgttttcctactgtggtattaat
aactgtgaaactcagtaacattgactcgtgcacatctacttatgggcatttccttgtctataatagagtacaatttcttt
tgaatcttccctccccagatgtcacaatggctgcaaacttcactatttcagacagtgagtcagaggcttcggaggaggta
gaggagggagaaatgaaccaatcatcaactgagcaagagcagcagattcctcaacgcaacaccgtcaccctccctgagct
cagactgccagtgcccggtcgaatcaggctgaactcagagtcccacgcttccactgcctccagagacgaggggctccagg
taaggggggaagaggaagccgggacgcccaccgagggagctccattccggggacggtccaagtcagctccccctgcgttg
tgggcagctaagaaatacggacagaagctccgaaggatgagcgatgagtttgacagcctgctagacaaaggggagatgag
gagggtgaagagcgctacaacgaccagacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggaga
cagaaggtgaaaacaaccaccacgaaaaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A4W6ETK4_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L11 (length=855 residues).
atgtatatatatatatgtatatgtacatataaatatatcacagacagcttgacatcgtgttattctcggagccagcggtt
atgtcgcgccactgacatgcaacctccgtccagaccaccaaaccagtccgatggctcgaccgaagtaacggcaagagagg
agagcggaggagatccacacgtcgacggtgccgctggagcctcggcgcaaacgtcccgttcgaacgacggcggcggcggc
ggcgagcggagctttggccaccgcggctccaccggaggaggagagctggcggactcgccgccccggtgcagaaccaaagc
catctcccctctcgacagcctaggcgtgtttcagaagaggtctatattcagctaccctcgccgctcctccagtggatatt
tctccttcgacggcgagtcgctgccgagctccccgctctccccgaggccagcgacggctgacagagccacgcagactccg
agccccaccagccaggtgatgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggaccggggacgcagcagct
gcacggaagctctcccaacccctctagcacacagcaacgcaacgcagcaggggacatgcagacggaggcagtaatcggac
aagagctccgacgcattggggacgatttcaacagactccttctgttaaggggggtggcaggtggacatagaccagttgtg
atccctcagcagcagctgccgcacatccaccaggagcccaccgtgctgttgtgtgtgggcatcctgctccttgtgattgg
acggataatctacttgcaaggcggtatgaacaaccaggaccacgctcaggtctag
>gnl|bcl2dbcds|A0A4W6ETK4_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L11 (length=684 residues).
atgaaagcccaggctgacggtgccgctctgttcatccaacagaccaccaaaccagtccgatggctcgaccgaagtaacgg
caagagaggagagcggaggagatccacacgtcgacggtgccgctggagcctcggcgcaaacgtcccgttcgaacgacggc
ggcggcggcggcgagcggagctttggccaccgcggctccaccggaggaggagagctggcggactcgccgccccggtccta
ggcgtgtttcagaagaggtctatattcagctaccctcgccgctcctccagtggatatttctccttcgacggcgagtcgct
gccgagctccccgctctccccgaggccagcgacggctgacagagccacgcagactccgagccccaccagccaggtgatga
aacacttcttgcagcgcatgaccgaggcgcacggcagaggaccggggacgcagcagctgcacgttgacaccccagtgctc
ctcctctctcccaacccctctagcacacagcaacgcaacgcagcaggggacatgcagacggaggcagtaatcggacaaga
gctccgacgcattggggacgatttcaacagactccttctgttaagggttagtcatcacaggcactgtgtgtgtgtgtgtg
tgtgtgtttgtgtgtgtgtgtgtgtgtgtgggagggggggttga
>gnl|bcl2dbcds|A0A4W6ETK4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L11 (length=747 residues).
caaagaccaccaaaccagtccgatggctcgaccgaagtaacggcaagagaggagagcggaggagatccacacgtcgacgg
tgccgctggagcctcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcggagctttggccaccgcggct
ccaccggaggaggagagctggcggactcgccgccccggtgcagaaccaaagccatctcccctctcgacagcctaggcgtg
tttcagaagaggtctatattcagctaccctcgccgctcctccagtggatatttctccttcgacggcgagtcgctgccgag
ctccccgctctccccgaggccagcgacggctgacagagccacgcagactccgagccccaccagccaggtgatgaaacact
tcttgcagcgcatgaccgaggcgcacggcagaggaccggggacgcagcagctgcacggaagctctcccaacccctctagc
acacagcaacgcaacgcagcaggggacatgcagacggaggcagtaatcggacaagagctccgacgcattggggacgattt
caacagactccttctgttaaggggggtggcaggtggacatagaccagttgtgatccctcagcagcagctgccgcacatcc
accaggagcccaccgtgctgttgtgtgtgggcatcctgctccttgtgattggacggataatctacttgcaaggcggtatg
aacaaccaggaccacgctcaggtctag
© 1998-2020Legal notice