Dataset for CDS classical BH3-containing proteins of organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W6EMZ7_BAD-01       --------------------------------------------------
A0A4W6EMZ7_BAD-02       atgtacaggaacaaatgttgtttggtcatcatttgtatgaataac-----
A0A4W6DUL1_BMF-01       atgga---------------------------------------------
A0A4W6ETK4_BCL2L11      atgaa---------------------------------------------
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      atgtatatatatatatgtatatgtacatataaatatatcacagacagctt

A0A4W6EMZ7_BAD-01       --------------------------------------------------
A0A4W6EMZ7_BAD-02       -------------------gtgcttaacgtttgttttcctactgtggtat
A0A4W6DUL1_BMF-01       --------------------------------------------------
A0A4W6ETK4_BCL2L11      -------------------agcccaggctgacggtgccgctctgttcatc
A0A4W6ETK4_BCL2L11      --------------------------------------------------
A0A4W6ETK4_BCL2L11      gacatcgtgttattctcggagccagcggttatgtcgcgccactg-acatg

A0A4W6EMZ7_BAD-01       --------------------------------------------------
A0A4W6EMZ7_BAD-02       taataactgtgaaactcagtaa-------cattgactcgtgcacatctac
A0A4W6DUL1_BMF-01       -----------------------------cgatg----------------
A0A4W6ETK4_BCL2L11      caa--------cagaccaccaaaccagtccgatggctcgaccgaagtaac
A0A4W6ETK4_BCL2L11      caa---------agaccaccaaaccagtccgatggctcgaccgaagtaac
A0A4W6ETK4_BCL2L11      caacctccgtccagaccaccaaaccagtccgatggctcgaccgaagtaac

A0A4W6EMZ7_BAD-01       --------------------------------------------------
A0A4W6EMZ7_BAD-02       ttatgggcatttccttgtctataatagagtacaatttcttttgaatcttc
A0A4W6DUL1_BMF-01       -----agga-----------------------------------------
A0A4W6ETK4_BCL2L11      ggcaagaga-----------------------------------------
A0A4W6ETK4_BCL2L11      ggcaagaga-----------------------------------------
A0A4W6ETK4_BCL2L11      ggcaagaga-----------------------------------------

A0A4W6EMZ7_BAD-01       -----------------atggctgcaaacttcactatttcagacagtgag
A0A4W6EMZ7_BAD-02       cctccccagatgtcacaatggctgcaaacttcactatttcagacagtgag
A0A4W6DUL1_BMF-01       -------ggatgatgtgtttgagccagaccccca-----ctgctggcgca
A0A4W6ETK4_BCL2L11      -------ggagagcggaggagatccacacgtcgacggtgccgctggagcc
A0A4W6ETK4_BCL2L11      -------ggagagcggaggagatccacacgtcgacggtgccgctggagcc
A0A4W6ETK4_BCL2L11      -------ggagagcggaggagatccacacgtcgacggtgccgctggagcc
                                            *   ** **  *       * *   * *  

A0A4W6EMZ7_BAD-01       tc-------------------agaggcttcggaggaggtagaggagggag
A0A4W6EMZ7_BAD-02       tc-------------------agaggcttcggaggaggtagaggagggag
A0A4W6DUL1_BMF-01       cc-------acattcagggagataaagtgcgaggaccggggcacgcagac
A0A4W6ETK4_BCL2L11      tcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcggag
A0A4W6ETK4_BCL2L11      tcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcggag
A0A4W6ETK4_BCL2L11      tcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcggag
                         *                   *       **  *   *  *      ** 

A0A4W6EMZ7_BAD-01       aaatgaac------caatcatcaactgagcaagagcagcagattcctcaa
A0A4W6EMZ7_BAD-02       aaatgaac------caatcatcaactgagcaagagcagcagattcctcaa
A0A4W6DUL1_BMF-01       acctggcc--------------------------------------ctgc
A0A4W6ETK4_BCL2L11      ctttggccaccgcggctccaccggaggaggagagctggcggactcgccgc
A0A4W6ETK4_BCL2L11      ctttggccaccgcggctccaccggaggaggagagctggcggactcgccgc
A0A4W6ETK4_BCL2L11      ctttggccaccgcggctccaccggaggaggagagctggcggactcgccgc
                           **  *                                          

A0A4W6EMZ7_BAD-01       cgcaacacc--------gtcaccctccct---------------------
A0A4W6EMZ7_BAD-02       cgcaacacc--------gtcaccctccct---------------------
A0A4W6DUL1_BMF-01       cctggcactgaacaacggcatgctgccct-------------gtggagtc
A0A4W6ETK4_BCL2L11      cccggt-------------------------------cctaggcgtgttt
A0A4W6ETK4_BCL2L11      cccggtgcagaaccaaagccatctcccctctcgacagcctaggcgtgttt
A0A4W6ETK4_BCL2L11      cccggtgcagaaccaaagccatctcccctctcgacagcctaggcgtgttt

A0A4W6EMZ7_BAD-01       ------gagctcaga--------------ctgcc------------agtg
A0A4W6EMZ7_BAD-02       ------gagctcaga--------------ctgcc------------agtg
A0A4W6DUL1_BMF-01       gaggaggagcccaga--------------ccactc-------------tt
A0A4W6ETK4_BCL2L11      cagaagaggtctatattcagctaccctcgccgctcctccagtggatattt
A0A4W6ETK4_BCL2L11      cagaagaggtctatattcagctaccctcgccgctcctccagtggatattt
A0A4W6ETK4_BCL2L11      cagaagaggtctatattcagctaccctcgccgctcctccagtggatattt
                                *   * *              *  *               * 

A0A4W6EMZ7_BAD-01       cccggtcgaatcaggctgaactcagagtcccacgcttccactgcctccag
A0A4W6EMZ7_BAD-02       cccggtcgaatcaggctgaactcagagtcccacgcttccactgcctccag
A0A4W6DUL1_BMF-01       ctacggcaacgcaggttttcgattgcacttcccg----------------
A0A4W6ETK4_BCL2L11      ctccttcgacggcgagtcgctgccgagctccccgctctccccgaggccag
A0A4W6ETK4_BCL2L11      ctccttcgacggcgagtcgctgccgagctccccgctctccccgaggccag
A0A4W6ETK4_BCL2L11      ctccttcgacggcgagtcgctgccgagctccccgctctccccgaggccag
                        *     * *    *  *       *     * **                

A0A4W6EMZ7_BAD-01       ---------------------agacgaggggct--ccaggtaagggggga
A0A4W6EMZ7_BAD-02       ---------------------agacgaggggct--ccaggtaagggggga
A0A4W6DUL1_BMF-01       -------------------gcacactttgagctcgctgggaatcaggaag
A0A4W6ETK4_BCL2L11      cgacggctgacagagccacgcagactccgagcc--ccaccagccaggtga
A0A4W6ETK4_BCL2L11      cgacggctgacagagccacgcagactccgagcc--ccaccagccaggtga
A0A4W6ETK4_BCL2L11      cgacggctgacagagccacgcagactccgagcc--ccaccagccaggtga
                                             * **   * **   *         **   

A0A4W6EMZ7_BAD-01       agagga----------------agccgggacgcccaccgagggagctcca
A0A4W6EMZ7_BAD-02       agagga----------------agccgggacgcccaccgagggagctcca
A0A4W6DUL1_BMF-01       cgaggc----------------gacaggaaagt---gaagaggagc----
A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggacc----
A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggacc----
A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggacc----
                         **                     * *    *         *** *    

A0A4W6EMZ7_BAD-01       ttccggggacggtccaagtcagctcccc----------------------
A0A4W6EMZ7_BAD-02       ttccggggacggtccaagtcagctcccc----------------------
A0A4W6DUL1_BMF-01       -----gaaacgggatggagcagctaccc----------------------
A0A4W6ETK4_BCL2L11      -----g----gggacgcagcagctgcacgttgacaccccagtgctcctcc
A0A4W6ETK4_BCL2L11      -----g----gggacgcagcagctgcacggaag-----------------
A0A4W6ETK4_BCL2L11      -----g----gggacgcagcagctgcacggaag-----------------
                             *    **       ***** * *                      

A0A4W6EMZ7_BAD-01       --------------------------ctgcg------------ttgtggg
A0A4W6EMZ7_BAD-02       --------------------------ctgcg------------ttgtggg
A0A4W6DUL1_BMF-01       --------------------------cagcg----gcagcctgtggcgcg
A0A4W6ETK4_BCL2L11      tctctcccaacccctctagcacacagcaacgcaacgcagcaggggacatg
A0A4W6ETK4_BCL2L11      -ctctcccaacccctctagcacacagcaacgcaacgcagcaggggacatg
A0A4W6ETK4_BCL2L11      -ctctcccaacccctctagcacacagcaacgcaacgcagcaggggacatg
                                                  *  **                  *

A0A4W6EMZ7_BAD-01       cagctaagaaata-----cggacagaagctccgaaggatgagcgatgagt
A0A4W6EMZ7_BAD-02       cagctaagaaata-----cggacagaagctccgaaggatgagcgatgagt
A0A4W6DUL1_BMF-01       cagtgtggaggcttgcattggccagaaactccagctgataggagaccagt
A0A4W6ETK4_BCL2L11      cag-acggaggcagtaatcggacaagagctccgacgcattggggacga-t
A0A4W6ETK4_BCL2L11      cag-acggaggcagtaatcggacaagagctccgacgcattggggacga-t
A0A4W6ETK4_BCL2L11      cag-acggaggcagtaatcggacaagagctccgacgcattggggacga-t
                        ***    **          ** **  * ****     **  * **  * *

A0A4W6EMZ7_BAD-01       tt-gacag-----cctgctagacaaaggggagatgagga-----------
A0A4W6EMZ7_BAD-02       tt-gacag-----cctgctagacaaaggggagatgagga-----------
A0A4W6DUL1_BMF-01       ttcaccgggaacacctacaact----------------------------
A0A4W6ETK4_BCL2L11      ttcaacag--actccttctgttaaggg--------------------tta
A0A4W6ETK4_BCL2L11      ttcaacag--actccttctgttaaggggggtggcaggtggacatagacca
A0A4W6ETK4_BCL2L11      ttcaacag--actccttctgttaaggggggtggcaggtggacatagacca
                        **   * *     *** *                                

A0A4W6EMZ7_BAD-01       --------------gggtgaagagcgctacaacgaccagacagatgcac-
A0A4W6EMZ7_BAD-02       --------------gggtgaagagcgctacaacgaccagacagatgcac-
A0A4W6DUL1_BMF-01       --------------gtatcatcgaaaccaaaggaaccag------gggc-
A0A4W6ETK4_BCL2L11      gtcatca-----------------------------cag------g----
A0A4W6ETK4_BCL2L11      gttgtgatccctcagcagcagctgccgcacatccaccag------gagcc
A0A4W6ETK4_BCL2L11      gttgtgatccctcagcagcagctgccgcacatccaccag------gagcc
                                                            ***      *    

A0A4W6EMZ7_BAD-01       cactctaaaagctggtggagcta-----------cctctttagtcaccag
A0A4W6EMZ7_BAD-02       cactctaaaagctggtggagcta-----------cctctttagtcaccag
A0A4W6DUL1_BMF-01       cgctgtggtggcgcctggctgcagctctgctgagcctcctgtttgacagg
A0A4W6ETK4_BCL2L11      cactgtgtgtgtgtgtgtgtgtg----tgtttgtgtgtgtgtgtgtgtgt
A0A4W6ETK4_BCL2L11      caccgtgctgttgtgtgtgggca----tcctgctccttgtgattggacgg
A0A4W6ETK4_BCL2L11      caccgtgctgttgtgtgtgggca----tcctgctccttgtgattggacgg
                        * *  *         **                      *   *      

A0A4W6EMZ7_BAD-01       gagac---------agaaggtgaaaacaaccaccacgaaaaccacactca
A0A4W6EMZ7_BAD-02       gagac---------agaaggtgaaaacaaccaccacgaaaaccacactca
A0A4W6DUL1_BMF-01       --ggcttcatcgctggaggaggtgg---agcaggacggaggtga------
A0A4W6ETK4_BCL2L11      gtg--------ggagggggggttga-------------------------
A0A4W6ETK4_BCL2L11      ataatctacttgcaaggcggtatgaacaaccaggaccacgctcaggtcta
A0A4W6ETK4_BCL2L11      ataatctacttgcaaggcggtatgaacaaccaggaccacgctcaggtcta
                                       *  *                               

A0A4W6EMZ7_BAD-01       ccgcactgagtag
A0A4W6EMZ7_BAD-02       ccgcactgagtag
A0A4W6DUL1_BMF-01       -------------
A0A4W6ETK4_BCL2L11      -------------
A0A4W6ETK4_BCL2L11      g------------
A0A4W6ETK4_BCL2L11      g------------

© 1998-2021Legal notice