Dataset for CDS BCL2L11 of organism Jaculus jaculus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5L6N3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L11 (length=426 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgctgagaggcctcccca
gcagctcaggcctggggcccctacctcccttcagacagtgccgcaagacaggagcccggcacccatgagttgtgacaaat
caacacaaaccccaagtcctccctgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggag
gaacctacagatatgcgtccagaaatatggattgcacaggagctgcggcgcatcggagatgagttcaatgcttactaccc
aaggagggtattcttgaataattaccaagcagctgaggaccaccctcaaatggttatcttaagactgttgcgttacttcg
tccgcctggtgtggagaagacattga
>gnl|bcl2dbcds|A0A8C5L6N3_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L11 (length=594 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgctgagaggcctcccca
gcagctcaggcctggggcccctacctcccttcagacagtgccgcaaggtaatcctgaaggcgaaggggaccgctgccccc
acggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtg
agaagatcttctctgctgtctcgatcttccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttg
tgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccattatctcagtgcaatggcttccataaggcagt
ctcaggaggaacctacagatatgcgtccagaaatatggattgcacaggagctgcggcgcatcggagatgagttcaatgct
tactacccaaggagggtattcttgaataattaccaagcagctgaggaccaccctcaaatggttatcttaagactgttgcg
ttacttcgtccgcctggtgtggagaagacattga
>gnl|bcl2dbcds|A0A8C5L6N3_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtggacaattgcagcctgctgagaggcctcccca
gcagctcaggcctggggcccctacctcccttcagacagtgccgcaagacaggagcccggcacccatgagttgtgacaaat
caacacaaaccccaagtcctccctgccaggccttcaaccattatctcagtgcaatgcacatccagagcaatccacaggat
cag
© 1998-2022Legal notice