Dataset for CDS BCL2L11 of organism Jaculus jaculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5L6N3_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
A0A8C5L6N3_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
A0A8C5L6N3_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
                        **************************************************

A0A8C5L6N3_BCL2L11      acaattgcagcctgctgagaggcctccccagcagctcaggcctggggccc
A0A8C5L6N3_BCL2L11      acaattgcagcctgctgagaggcctccccagcagctcaggcctggggccc
A0A8C5L6N3_BCL2L11      acaattgcagcctgctgagaggcctccccagcagctcaggcctggggccc
                        **************************************************

A0A8C5L6N3_BCL2L11      ctacctcccttcagacagtgccgca-------------------------
A0A8C5L6N3_BCL2L11      ctacctcccttcagacagtgccgca-------------------------
A0A8C5L6N3_BCL2L11      ctacctcccttcagacagtgccgcaaggtaatcctgaaggcgaaggggac
                        *************************                         

A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      cgctgcccccacggcagccctcagggcccgctggccccaccggccagccc
                                                                          

A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      tggcccttttgctaccagatccccacttttcatctttgtgagaagatctt
                                                                          

A0A8C5L6N3_BCL2L11      -------------------------------------------agacagg
A0A8C5L6N3_BCL2L11      -------------------------------------------agacagg
A0A8C5L6N3_BCL2L11      ctctgctgtctcgatcttccagtgggtatttctcttttgacacagacagg
                                                                   *******

A0A8C5L6N3_BCL2L11      agcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcc
A0A8C5L6N3_BCL2L11      agcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcc
A0A8C5L6N3_BCL2L11      agcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctcc
                        **************************************************

A0A8C5L6N3_BCL2L11      ctgccaggccttcaaccattatctcagtgcaatg----------------
A0A8C5L6N3_BCL2L11      ctgccaggccttcaaccattatctcagtgcaatggcttccataaggcagt
A0A8C5L6N3_BCL2L11      ctgccaggccttcaaccattatctcagtgcaatggcttccataaggcagt
                        **********************************                

A0A8C5L6N3_BCL2L11      ---------------------cacatccaga-----gcaatccacaggat
A0A8C5L6N3_BCL2L11      ctcaggaggaacctacagatatgcgtccagaaatatggattgcacaggag
A0A8C5L6N3_BCL2L11      ctcaggaggaacctacagatatgcgtccagaaatatggattgcacaggag
                                               * ******     * * * ******* 

A0A8C5L6N3_BCL2L11      cag-----------------------------------------------
A0A8C5L6N3_BCL2L11      ctgcggcgcatcggagatgagttcaatgcttactacccaaggagggtatt
A0A8C5L6N3_BCL2L11      ctgcggcgcatcggagatgagttcaatgcttactacccaaggagggtatt
                        * *                                               

A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      cttgaataattaccaagcagctgaggaccaccctcaaatggttatcttaa
A0A8C5L6N3_BCL2L11      cttgaataattaccaagcagctgaggaccaccctcaaatggttatcttaa
                                                                          

A0A8C5L6N3_BCL2L11      --------------------------------------------
A0A8C5L6N3_BCL2L11      gactgttgcgttacttcgtccgcctggtgtggagaagacattga
A0A8C5L6N3_BCL2L11      gactgttgcgttacttcgtccgcctggtgtggagaagacattga
                                                                    

© 1998-2022Legal notice