Dataset for CDS classical BH3-containing proteins of organism Ictalurus punctatus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2D0SYM2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictalurus punctatus GN=BAD (length=597 residues).
atgagcaatcaatacctactgagactgaggaaagctcgttttaatttcgataaggaggaatatacaaaagtaataaacac
cagaataggaagtgaaggaggaggaaccattctgaatcacttcttcgggaattcatcaagaattacagctttcacaatgg
atgagacaccacaaagcgtaagaggagatgccggtcctgtggatgacaaagaatcaagatggtcagagacagtcgagaat
actgactctccaagcgtcggaggtcgagtacgactctactctgagtcccaggtgcacacggtgagccgctgggaagatgc
tgagctccaggatggaatttcagctgaagagagcggaggagcttcagacggagccccattccgaggccgatcccaatctg
ctcctgctgcactgtggaaagctaagaagtatggacgacagctgaggaggatgagtgatgaatttgacacctggctggac
agaggggacataaggagagtgagcagtcctgggaaagtgtcacagaagcaatccaaccgtgggtggttctccttcctctg
gggatctagagaggaggaggaggagggaagagaataa
>gnl|bcl2dbcds|W5UAU7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ictalurus punctatus GN=BMF (length=459 residues).
atggatgaggatgaggatgaggtgtttgggcctatctcacagtgctggccttcctccaacagggagataaagcaggagga
ccacagcacgcagaccccagggagccctgcggtacggctaaatggcatgctgccctgtggcgtggccgaggagcccagac
gactcttctatggtagtgcaggattgctattgctgacgccatctgcccgtactaaccgcgtcgaggacgccatgtttcct
gagaatcggcctcgccgacggcctgcgcacagcgtggaggctcagatcggccagaaactccagatgattggcgaccaatt
ctatcaagagcacatgctgcaacaccaaaaccaaaggaaccagtggccattttggttgcgtttggcctcagcattgtacg
cgctcctgttcgatggcgagcccgcggttcacaggaggagacaggaggatcgcagatga
>gnl|bcl2dbcds|W5UEE7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ictalurus punctatus GN=BCL2L11 (length=666 residues).
atgctctttgctcgtcgtcgtcggtttttcttctgtccttggtctcctgaagccgtatgccccagaaacatgtccaaacg
gcaataccgggccgatggcccagccttcttaaaggagcatgggggacgcggagagagcgcctcccgggccgagccgtatg
agagccctcagcacagagaattggaagtgattaggggagggatcgcgctgccgaatagccgcgtggcttaccagtcgagg
tcgcctgtgttccgaaccctctccaggtcgtcgagtggatatttttcgttcgacagtgagccgagctctccgctaatcac
ccatagcacagccactcagaccccgagtccgtctagtcaagtgataactcacgccctgcagcgcatttccaaagcgcgag
gcgacgcgcagaatcatgaattatggcctgctctccttaaccactatccaccccacggagcagcatctgcgggggacatg
caagcggagttggaaattgcgcgagagttgcggcgcatcggcgatgaatttaaccagctttattttcatgaggcagaaag
aaatggtggcgcagcccgtccgcaggcccaaaacgagcccgccatcatgctgtggattgggctcctgattggacggctat
tacaattcttcctgagacaaagatga
© 1998-2020Legal notice