Dataset for CDS classical BH3-containing proteins of organism Ictalurus punctatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2D0SYM2_BAD-01      atgagcaatcaatacctactgagactgaggaaagctcgttttaatttcga
W5UAU7_BMF-01          atgga--------------tgaggatgaggatgaggtgtttg--------
W5UEE7_BCL2L11-01      at--------------------------------gctctttgctcgtcgt
                       **                                    ***         

A0A2D0SYM2_BAD-01      taaggaggaatatacaaaagtaataaacacca------------------
W5UAU7_BMF-01          ------ggcctatctcacagtgctggccttcc------------------
W5UEE7_BCL2L11-01      c--gtcggtttttcttctgtccttggtctcctgaagccgtatgccccaga
                             **  * *          *   *  *                   

A0A2D0SYM2_BAD-01      ---------gaataggaagtgaaggaggaggaaccattctgaatcacttc
W5UAU7_BMF-01          ------tccaa----------cagggagataaagca--------------
W5UEE7_BCL2L11-01      aacatgtccaaacggcaataccgggccgatggccca--------------
                                 *            **  **     **              

A0A2D0SYM2_BAD-01      ttcgggaattcatcaagaattacagctttcacaatggatgagacacc---
W5UAU7_BMF-01          -----g--------gaggaccacag----cacgcaga-------ccccag
W5UEE7_BCL2L11-01      -----gccttcttaaaggagcatgggggacgcggagagagcgcctcccgg
                            *         ** *  *  *    * *   *         **   

A0A2D0SYM2_BAD-01      -acaaagcgtaagaggagatgccggtcctgtggatgacaaagaatcaaga
W5UAU7_BMF-01          g-------------g--------agccctgcggt--acggctaa-----a
W5UEE7_BCL2L11-01      gccgagccgtatgag--------agccct-cagc--acagagaa-----t
                                     *         * ***   *   **    **      

A0A2D0SYM2_BAD-01      tggtcagagacagtcgagaatactgactctccaagcgtcg-gaggtcgag
W5UAU7_BMF-01          tgg-------------------catgctgcc---ctgtggcgtggccgag
W5UEE7_BCL2L11-01      tggaagtgattaggggagggatcgcgctgccgaatagccgcgtggcttac
                       ***                   *   **  *     *  * * **   * 

A0A2D0SYM2_BAD-01      ta-------------------cgactctactctgagtc-ccaggtgcaca
W5UAU7_BMF-01          gagcccaga------------cgactcttctatgg------tagtgcagg
W5UEE7_BCL2L11-01      cagtcgaggtcgcctgtgttccgaaccctctccaggtcgtcgagtggata
                        *                   ***  *  **            *** *  

A0A2D0SYM2_BAD-01      ----cggtgagccgctgggaaga------tgctgagctccagga------
W5UAU7_BMF-01          attgctatt---------gctga------cgccatctgcccgta------
W5UEE7_BCL2L11-01      tttttcgttcgacagtgagccgagctctccgctaatcacccatagcacag
                              *          *  **       **      **   *      

A0A2D0SYM2_BAD-01      ----tggaatttcagctgaagagagcggaggagcttcagac-----ggag
W5UAU7_BMF-01          -----------ctaaccgcgtcgagg-------------acgccatg---
W5UEE7_BCL2L11-01      ccactcagaccccgagtccgtctagtcaagtgataactcacgccctgcag
                                              **              **     *   

A0A2D0SYM2_BAD-01      ccccattccgaggccgatcccaatctgct----------------cctgc
W5UAU7_BMF-01          ----tttcctgag---aatcggcctcgccg-----------acggcctgc
W5UEE7_BCL2L11-01      cgcatttccaaagcgcgaggcgacgcgcagaatcatgaattatggcctgc
                            ****   *             **                 *****

A0A2D0SYM2_BAD-01      t-------------------------gcactgt--------------gga
W5UAU7_BMF-01          --------------------------gcacagc-----------------
W5UEE7_BCL2L11-01      tctccttaaccactatccaccccacggagcagcatctgcgggggacatgc
                                                 *  * *                  

A0A2D0SYM2_BAD-01      aagctaagaagta---tggacgacagctgaggaggatgagtgatgaattt
W5UAU7_BMF-01          --gtggaggctcagatcggccagaaactccagatgattggcgaccaattc
W5UEE7_BCL2L11-01      aagcggagttggaaattgcgcgagagttgcggcgcatcggcgatgaattt
                         *   **    *    *  *   *  *   *   **  * **  **** 

A0A2D0SYM2_BAD-01      gacac------ctggctggacag--aggggacataaggag--agtgagca
W5UAU7_BMF-01          tatcaagagcacatgctgcaacacca--aaaccaaaggaaccagtggc-c
W5UEE7_BCL2L11-01      aacca---------gctttattttcatgaggcagaaagaaatggtggcgc
                        *            ***  *     *     *  ** **    ***    

A0A2D0SYM2_BAD-01      gtcctgggaaagtgtcacagaag---------caatccaaccgtgggtgg
W5UAU7_BMF-01          attttggttgcgtttggcctcag----------cattgtac--------g
W5UEE7_BCL2L11-01      agcccgtccgca---ggcccaaaacgagcccgccatcatgctgtggattg
                            *           *   *            **    *        *

A0A2D0SYM2_BAD-01      ttctcct--tcctctggggatctagag------aggaggagg-aggaggg
W5UAU7_BMF-01          cgctcctg-ttcgatggcgagcccgcggttcacaggaggagacaggagga
W5UEE7_BCL2L11-01      ggctcctgattggacggctattacaattcttcc----tgagacaa-----
                         *****  *     **  *                  ***  *      

A0A2D0SYM2_BAD-01      aagagaataa
W5UAU7_BMF-01          tcgcagatga
W5UEE7_BCL2L11-01      ----agatga
                             ** *

© 1998-2020Legal notice