Dataset for CDS BCL2L11 of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W5NF23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=636 residues).
atgaaccacaatatcggtccaaatgtctcgaccaccctaattgagagaaggaaaagcggagagtcgcatcccggtggcgg
agcagcctcccgtgccgaaccgtctgacaacccccagtcctgcgaaggggaccagcagtcacggggaggaataatgattc
cgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtacaggtcctccagtggatatttttcgttc
gacagcgattctattccaagctccccgctattgaaagataacaagtcgacacagactccgagcccatctagccaagtcat
tacccacgcactgcagcgcctgtctcgggcactggagacccggcgagattatgacgtgtggcccaaccccctccggccct
atagagcacgcccaccaccgactgcgggggacatgcggccagagatactcatcggtcaggagcttcggcgcattggagat
gagtttaacaacctcttcatacatcggcgccttgcaggcagaaacggtcaggttgcccagggaaacctgcagcagatgca
ccaagagcccgccttcctactgtggatgggtcttctgattggacgactattacagataatcctgcggagaagatga
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=693 residues).
atgacattgcaccgacaaaataataaaaatagcctaactctgatacttgatctatcttacagacaacaaaatcaatccaa
tggctcgaccatcctaattgagagagggaaatacggagaattgaatcccggtggcggagcagcctccggtgccgaaccga
ctgacatcccccagttcagcgaaggggaccagcagtcacgtggaggaataatgatgccgaatagtctgcttggtttccag
tcgaggtcgccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcgacagcgattctattccaagctc
cccgctattgaaagataacaagtcgacacagactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatgt
ctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccctccacccctatagaccacggccacaaccaact
gcaggggacatgtggccagagacactgatcggtcaggagcttcagcgcattggagatgagtttaaccatctcttcataca
tgggcaccttcctggcagaaacgctcaagttgcccaggcaaacctgcagcagatgcaccaagagcccgccttcctactgt
ggatggggctcctgattggacgactattacagatcatcctgcagagaagatga
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=699 residues).
atgacattgcaccgacaaaataataaaaatagcctaactctgatacttgatctatcttacagacaacaaaatcaatccaa
tggctcgaccatcctaattgagagagggaaatacggagaattgaatcccggtggcggagcagcctccggtgccgaaccga
ctgacatcccccagttcagcgaaggggaccagcagtcacgtggaggaataatgatgccgaatagtctgcttggtttccag
tcgaggtcgccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcgacagcgattctattccaagctc
cccgctattgaaagataacaagtcgacacagactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatgt
ctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccctccacccctatagaccacggccacaaccaact
gcaggggacatgtggccagagacactgatcggtcaggagcttcagcgcattggagatgagtttaaccatctcttcataca
tggggtgagtaggtacaccacaccagcactgagtcttgtatatacacataaagggttggaggagccacagattagtaaag
atgatgataatgccccttatatccagaagatgcatcattttgggcgcgttagcatttaa
>gnl|bcl2dbcds|A0A4W5R3N6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Hucho hucho GN=BCL2L11 (length=648 residues).
atgaccgattcgtccagacaacaaaatcaatccaatggctcgaccatcctaattgagagagggaaatacggagaattgaa
tcccggtggcggagcagcctccggtgccgaaccgactgacatcccccagttcagcgaaggggaccagcagtcacgtggag
gaataatgatgccgaatagtctgcttggtttccagtcgaggtcgccggtgttcagaacactgtccaggtcatccagtgga
tatttttcgttcgacagcgattctattccaagctccccgctattgaaagataacaagtcgacacagactccgagcccatc
aagccaaatcatgactcacgcactgcagcgcatgtctcaagcacaggagaccaatcgagattatgacgcgtggcccaacc
ccctccacccctatagaccacggccacaaccaactgcaggggacatgtggccagagacactgatcggtcaggagcttcag
cgcattggagatgagtttaaccatctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggcaaacct
gcagcagatgcaccaagagcccgccttcctactgtggatggggctcctgattggacgactattacagatcatcctgcaga
gaagatga
© 1998-2020Legal notice