Dataset for CDS BCL2L11 of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5NF23_BCL2L11      atga----------------------------------------------
A0A4W5R3N6_BCL2L11      atgacattgcaccgacaaaataataaaaatagcctaactctgatacttga
A0A4W5R3N6_BCL2L11      atgac------------------------------------------cga
A0A4W5R3N6_BCL2L11      atgacattgcaccgacaaaataataaaaatagcctaactctgatacttga

A0A4W5NF23_BCL2L11      ------------accacaatatcggtccaaatgtctcgaccaccctaatt
A0A4W5R3N6_BCL2L11      tctatcttacagacaacaaaatcaatcc-aatggctcgaccatcctaatt
A0A4W5R3N6_BCL2L11      ttcgtc---cagacaacaaaatcaatcc-aatggctcgaccatcctaatt
A0A4W5R3N6_BCL2L11      tctatcttacagacaacaaaatcaatcc-aatggctcgaccatcctaatt
                                    ** **** ***  *** **** ******** *******

A0A4W5NF23_BCL2L11      gagagaaggaaaagcggagagtcgcatcccggtggcggagcagcctcccg
A0A4W5R3N6_BCL2L11      gagagagggaaatacggagaattgaatcccggtggcggagcagcctccgg
A0A4W5R3N6_BCL2L11      gagagagggaaatacggagaattgaatcccggtggcggagcagcctccgg
A0A4W5R3N6_BCL2L11      gagagagggaaatacggagaattgaatcccggtggcggagcagcctccgg
                        ****** *****  ****** * * *********************** *

A0A4W5NF23_BCL2L11      tgccgaaccgtctgacaacccccagtcctgcgaaggggaccagcagtcac
A0A4W5R3N6_BCL2L11      tgccgaaccgactgacatcccccagttcagcgaaggggaccagcagtcac
A0A4W5R3N6_BCL2L11      tgccgaaccgactgacatcccccagttcagcgaaggggaccagcagtcac
A0A4W5R3N6_BCL2L11      tgccgaaccgactgacatcccccagttcagcgaaggggaccagcagtcac
                        ********** ****** ******** * *********************

A0A4W5NF23_BCL2L11      ggggaggaataatgattccgaatagtctgcttggtttccagtcgaggtcg
A0A4W5R3N6_BCL2L11      gtggaggaataatgatgccgaatagtctgcttggtttccagtcgaggtcg
A0A4W5R3N6_BCL2L11      gtggaggaataatgatgccgaatagtctgcttggtttccagtcgaggtcg
A0A4W5R3N6_BCL2L11      gtggaggaataatgatgccgaatagtctgcttggtttccagtcgaggtcg
                        * ************** *********************************

A0A4W5NF23_BCL2L11      ccggtgttcagaacactgtacaggtcctccagtggatatttttcgttcga
A0A4W5R3N6_BCL2L11      ccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcga
A0A4W5R3N6_BCL2L11      ccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcga
A0A4W5R3N6_BCL2L11      ccggtgttcagaacactgtccaggtcatccagtggatatttttcgttcga
                        ******************* ****** ***********************

A0A4W5NF23_BCL2L11      cagcgattctattccaagctccccgctattgaaagataacaagtcgacac
A0A4W5R3N6_BCL2L11      cagcgattctattccaagctccccgctattgaaagataacaagtcgacac
A0A4W5R3N6_BCL2L11      cagcgattctattccaagctccccgctattgaaagataacaagtcgacac
A0A4W5R3N6_BCL2L11      cagcgattctattccaagctccccgctattgaaagataacaagtcgacac

A0A4W5NF23_BCL2L11      agactccgagcccatctagccaagtcattacccacgcactgcagcgcctg
A0A4W5R3N6_BCL2L11      agactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatg
A0A4W5R3N6_BCL2L11      agactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatg
A0A4W5R3N6_BCL2L11      agactccgagcccatcaagccaaatcatgactcacgcactgcagcgcatg
                        **************** ****** **** ** *************** **

A0A4W5NF23_BCL2L11      tctcgggcactggagacccggcgagattatgacgtgtggcccaaccccct
A0A4W5R3N6_BCL2L11      tctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccct
A0A4W5R3N6_BCL2L11      tctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccct
A0A4W5R3N6_BCL2L11      tctcaagcacaggagaccaatcgagattatgacgcgtggcccaaccccct
                        ****  **** *******   ************* ***************

A0A4W5NF23_BCL2L11      ccggccctatagagcacgcccaccaccgactgcgggggacatgcggccag
A0A4W5R3N6_BCL2L11      ccacccctatagaccacggccacaaccaactgcaggggacatgtggccag
A0A4W5R3N6_BCL2L11      ccacccctatagaccacggccacaaccaactgcaggggacatgtggccag
A0A4W5R3N6_BCL2L11      ccacccctatagaccacggccacaaccaactgcaggggacatgtggccag
                        **  ********* **** **** *** ***** ********* ******

A0A4W5NF23_BCL2L11      agatactcatcggtcaggagcttcggcgcattggagatgagtttaacaac
A0A4W5R3N6_BCL2L11      agacactgatcggtcaggagcttcagcgcattggagatgagtttaaccat
A0A4W5R3N6_BCL2L11      agacactgatcggtcaggagcttcagcgcattggagatgagtttaaccat
A0A4W5R3N6_BCL2L11      agacactgatcggtcaggagcttcagcgcattggagatgagtttaaccat
                        *** *** **************** ********************** * 

A0A4W5NF23_BCL2L11      ctcttcatacatcggcgccttgcaggcagaaacggtcaggttgcccaggg
A0A4W5R3N6_BCL2L11      ctcttcatacatggg------gtgagtaggtacac--------------c
A0A4W5R3N6_BCL2L11      ctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggc
A0A4W5R3N6_BCL2L11      ctcttcatacatgggcaccttcctggcagaaacgctcaagttgcccaggc
                        ************ **          * **  **                 

A0A4W5NF23_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
A0A4W5R3N6_BCL2L11      acaccagcactgagtcttgtatatacacataaag-------------ggt
A0A4W5R3N6_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
A0A4W5R3N6_BCL2L11      aaacctgca---------gcagatgcaccaagagcccgccttcctactgt
                        * *** ***         * * ** ***  * **              **

A0A4W5NF23_BCL2L11      ggatgggtcttctgattgg--acgactattacagataatcctgcgg--ag
A0A4W5R3N6_BCL2L11      tggaggagccacagattagtaaagatgatgataatgccccttatatccag
A0A4W5R3N6_BCL2L11      ggatggggctcctgattgg--acgactattacagatcatcctgcag--ag
A0A4W5R3N6_BCL2L11      ggatggggctcctgattgg--acgactattacagatcatcctgcag--ag
                         *  **  *  * **** *  * **  ** * *      * *      **

A0A4W5NF23_BCL2L11      aagatg--------------------------a
A0A4W5R3N6_BCL2L11      aagatgcatcattttgggcgcgttagcatttaa
A0A4W5R3N6_BCL2L11      aagatg--------------------------a
A0A4W5R3N6_BCL2L11      aagatg--------------------------a
                        ******                          *

© 1998-2020Legal notice