Dataset for CDS classical BH3-containing proteins of organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A8MXU7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A8MXU7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|B4DQK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=600 residues).
atggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggt
tcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcgg
cggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|B4DZQ9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagccccaggcgcctgcgctaa
>gnl|bcl2dbcds|O43521_BCL2L11-20 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgtcacccaggctggagtgcactggtgc
gatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|Q6JTU4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=111 residues).
atgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtatcggagacgagtttaa
cgcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|Q9BXH1_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=306 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtgagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|Q9BXH1_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=786 residues).
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtgggtcccctgcca
gatttgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgc
gacggcccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctgg
ggggttcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacg
agcggcggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctg
cccttacccaggggccacagagcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
© 1998-2020Legal notice