Dataset for CDS classical BH3-containing proteins of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q6JTU4_BCL2L11-01      atg-----------------------------------------------
O43521_BCL2L11-20      atg----------------------------------gcaaagcaacctt
Q9BXH1_BBC3-04         atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgccc--
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-03         atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgccc--
A8MXU7_BAD-03          atgttccagatcccagagtttga--------------gccgagtgagc--
A8MXU7_BAD-04          atgttccagatcccagagtttga--------------gccgagtgagc--
B4DZQ9_BAD-01          atgttccagatcccagagtttga--------------gccgagtgagc--

Q6JTU4_BCL2L11-01      ---aggcaggct----------------------gaacctg------cag
O43521_BCL2L11-20      ctgatgtaagtt--------------------ctgagtgtga-----ccg
Q9BXH1_BBC3-04         ---agggctgcttccacgacgtgggtcccctgccagatttgt--------
B4DQK3_BBC3-01         ----------------------------------------atggccccag
Q9BXH1_BBC3-03         ---agggctgcttccacgacgtgggtcccctgccagatttgtggccccag
A8MXU7_BAD-03          ---aggaagact--------------------ccagctctg------cag
A8MXU7_BAD-04          ---aggaagact--------------------ccagctctg------cag
B4DZQ9_BAD-01          ---aggaagact--------------------ccagctctg------cag

Q6JTU4_BCL2L11-01      atatg---------------cgcccagagatatggatcgc----------
O43521_BCL2L11-20      agaagg---tagacaattgcagcctgcggagaggcctccccagctcagac
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         ggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgta
Q9BXH1_BBC3-03         ggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgta
A8MXU7_BAD-03          agaggggcctgggccccagccccgcaggggacgggccctcaggctccggc
A8MXU7_BAD-04          agaggggcctgggccccagccccgcaggggacgggccctcaggctccggc
B4DZQ9_BAD-01          agaggggcctgggccccagccccgcaggggacgggccctcaggctccggc

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------ctggggcccctacctccc-----------------t
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         gagggcctggcccgcgacggcccgcgccccttcccgctcggccgcctggt
Q9BXH1_BBC3-03         gagggcctggcccgcgacggcccgcgccccttcccgctcggccgcctggt
A8MXU7_BAD-03          aagcatc---atcgccaggccccaggcctcct----gtgggacgccagtc
A8MXU7_BAD-04          aagcatc---atcgccaggccccaggcctcct----gtgggacgccagtc
B4DZQ9_BAD-01          aagcatc---atcgccaggccccaggcctcct----gtgggacgccagtc

Q6JTU4_BCL2L11-01      -ccaagagttgcggcgta-------------------------------t
O43521_BCL2L11-20      acagacag------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         gccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
Q9BXH1_BBC3-03         gccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
A8MXU7_BAD-03          accagcaggagcagccaa-------------------------------c
A8MXU7_BAD-04          accagcaggagcagccaa-------------------------------c
B4DZQ9_BAD-01          accagcaggagcagccaa-------------------------------c

Q6JTU4_BCL2L11-01      cggagacgagtttaacgct-------------------------------
O43521_BCL2L11-20      -agccacaagtctca-----------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgcc
Q9BXH1_BBC3-03         ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgcc
A8MXU7_BAD-03          cagcagcagccatcatggagaagg--------------gacttcct----
A8MXU7_BAD-04          cagcagcagccatcatggagggag--------------aacttcgtattc
B4DZQ9_BAD-01          cagcagcagccatcatg---------------------------------

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         ccacccgccgtcaccgccgccctggggggttcccgctggcctgggggtcc
Q9BXH1_BBC3-03         ccacccgccgtcaccgccgccctggggggttcccgctggcctgggggtcc
A8MXU7_BAD-03          --------------------------------------------------
A8MXU7_BAD-04          tccttcttgggaatctgaggactctgaaaatcccagtgcagggatgctcg
B4DZQ9_BAD-01          --------------------------------------------------

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         ccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctct
Q9BXH1_BBC3-03         ccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctct
A8MXU7_BAD-03          --------------------------------------------------
A8MXU7_BAD-04          cggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaa
B4DZQ9_BAD-01          --------------------------------------------------

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         cgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggct
Q9BXH1_BBC3-03         cgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggct
A8MXU7_BAD-03          cgcccgaagagcg---------------cgggcacagcaacgcagatgcg
A8MXU7_BAD-04          cacgcagagaatg---------------taaagctagaggcgctggggct
B4DZQ9_BAD-01          ------------------------------------gaggcgctggggct

Q6JTU4_BCL2L11-01      -------------------------------tactatgcaaggaggt---
O43521_BCL2L11-20      -------------------------ctctgtcacccaggctggagtg---
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         ctggcgggcggtcccacccaggcggccccgggagtccgcggggaggagga
Q9BXH1_BBC3-03         ctggcgggcggtcccacccaggcggccccgggagtccgcggggaggagga
A8MXU7_BAD-03          gcaaagctccagctggacgcgagtcttcc--agtcctggtgggatcg---
A8MXU7_BAD-04          gtggagatccgg--agtcgccacagctcc--taccccgcggggacggagg
B4DZQ9_BAD-01          gtggagatccgg--agtcgccacagctcc--taccccgcggggacggagg

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
B4DQK3_BBC3-01         acagtgggcccgggagatcggggcccagctgcggcggatggcggacgacc
Q9BXH1_BBC3-03         acagtgggcccgggagatcggggcccagctgcggcggatggcggacgacc
A8MXU7_BAD-03          -----g--------------------------------------------
A8MXU7_BAD-04          acgacg--------------------------------------------
B4DZQ9_BAD-01          acgacg--------------------------------------------

Q6JTU4_BCL2L11-01      ---------------------------tagagaaatag------------
O43521_BCL2L11-20      ---------------------------cactggtgcgatcttggctca--
Q9BXH1_BBC3-04         ----------------------gagacaagaggagcagcagcggcaccgc
B4DQK3_BBC3-01         tcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgc
Q9BXH1_BBC3-03         tcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgc
A8MXU7_BAD-03          ---------------------------aacttgggcaggggaagctccgc
A8MXU7_BAD-04          ---------------------------aagggatgggggaggagcccagc
B4DZQ9_BAD-01          ---------------------------aagggatgggggaggagcccagc

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------ctgcaacctccaactcccaagttcaagcgg
Q9BXH1_BBC3-04         ccctcaccctggagggtcctgtacaatct-catcatgggactcctgccct
B4DQK3_BBC3-01         ccctcaccctggagggtcctgtacaatct-catcatgggactcctgccct
Q9BXH1_BBC3-03         ccctcaccctggagggtcctgtacaatct-catcatgggactcctgccct
A8MXU7_BAD-03          cccctccc---agtgacctt---cgctccacatcccgaaactccacccgt
A8MXU7_BAD-04          ccctttc-----ggggccgctcgcgctcggcgccccccaac---------
B4DZQ9_BAD-01          ccctttc-----ggggccgttcgcgctcggcgccccccaac---------

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      ttctcctgcct---------cagc------------------------ct
Q9BXH1_BBC3-04         tac-----ccaggggccacagagc------------------------cc
B4DQK3_BBC3-01         tac-----ccaggggccacagagc------------------------cc
Q9BXH1_BBC3-03         tac-----ccaggggccacagagc------------------------cc
A8MXU7_BAD-03          tcccactgccctgggcagc-catcttgaatatgggcggaagtacttccct
A8MXU7_BAD-04          --------ctctgggcagcacagc---gctatggccgcgag-------ct
B4DZQ9_BAD-01          --------ctctgggcagcacagc---gctatggccgcgag-------ct

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      cccaagtag-----------------------------------------
Q9BXH1_BBC3-04         ccga--gatgg------------------agcccaattaggtgcctgcac
B4DQK3_BBC3-01         ccga--gatgg------------------agcccaattag----------
Q9BXH1_BBC3-03         ccga--gatgg------------------agcccaattaggtgcctgcac
A8MXU7_BAD-03          caggcctatgcaaaaagaggatccgtgctgtctcctttggagggagg---
A8MXU7_BAD-04          ccggaggatga---------------------------------------
B4DZQ9_BAD-01          ccggaggatgagtgacgag----tttgtggactcctttaagaagggactt

Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
Q9BXH1_BBC3-04         ccgcccggtggacgtcagggactcggggggcaggcccctcccacctcctg
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-03         ccgcccggtggacgtcagggactcggggggcaggcccctcccacctcctg
A8MXU7_BAD-03          -----------------------------gctgacccagattcccttccg
A8MXU7_BAD-04          --------------------------------------------------
B4DZQ9_BAD-01          cctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagccccag

Q6JTU4_BCL2L11-01      -----------------------------------------
O43521_BCL2L11-20      -----------------------------------------
Q9BXH1_BBC3-04         acaccctggccagcgcgggggactttctctgcaccatgtag
B4DQK3_BBC3-01         -----------------------------------------
Q9BXH1_BBC3-03         acaccctggccagcgcgggggactttctctgcaccatgtag
A8MXU7_BAD-03          gtgcgtgtga-------------------------------
A8MXU7_BAD-04          -----------------------------------------
B4DZQ9_BAD-01          gcgcctgcgctaa----------------------------

© 1998-2020Legal notice