Dataset for CDS classical BH3-containing proteins of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

41 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q13794_PMAIP1-01       atg-----------------------------------------------
Q13794_PMAIP1-02       atg-----------------------------------------------
O43521_BCL2L11-16      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-02      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-15      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-03      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-23      ------aagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-07      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-22      atggcaaagcaaccttctgatgtaagttctga------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-17      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-09      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-14      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-04      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-21      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-19      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-18      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-12      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-11      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-10      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-08      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-06      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-01      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-05      atggcaaagcaaccttctgatgtaagttctga------------------
O43521_BCL2L11-13      atggcaaagcaaccttctgatgtaagttctga------------------
Q9BXH1_BBC3-04         atgaaattt----g------------------------------------
Q9BXH1_BBC3-05         atgaaattt----g------------------------------------
Q9BXH1_BBC3-06         atgaaattt----ggcatggggtctgcccaggcatgtccatgccaggtgc
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DZQ9_BAD-01          atgttccag----atcccagagtttgagccga------------------
Q96LC9_BMF-05          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-07          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-06          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-01          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-02          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-03          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-04          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-08          atggagcc-----atctcagtgtgtg----ga------------------
Q96LC9_BMF-09          atggagcc-----atctcagtgtgtg----ga------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
O43521_BCL2L11-16      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-02      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-15      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-03      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-23      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-07      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-22      -------------------------------------gtgtgaccgagaa
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-17      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-09      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-14      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-04      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-21      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-19      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-18      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-12      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-11      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-10      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-08      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-06      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-01      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-05      -------------------------------------gtgtgaccgagaa
O43521_BCL2L11-13      -------------------------------------gtgtgaccgagaa
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-06         ccagggctgcttccacgacgtgggtcccctgccagatttgtggccccagg
B4DQK3_BBC3-01         ---------------------------------------atggccccagg
Q9BXH1_BBC3-03         --------------------------------------------------
B4DZQ9_BAD-01          ---------------------------------------gtgagcaggaa
Q96LC9_BMF-05          ---------------------------------------g-gagctggag
Q96LC9_BMF-07          ---------------------------------------g-gagctggag
Q96LC9_BMF-06          ---------------------------------------g-gagctggag
Q96LC9_BMF-01          ---------------------------------------g-gagctggag
Q96LC9_BMF-02          ---------------------------------------g-gagctggag
Q96LC9_BMF-03          ---------------------------------------g-gagctggag
Q96LC9_BMF-04          ---------------------------------------g-gagctggag
Q96LC9_BMF-08          ---------------------------------------g-gagctggag
Q96LC9_BMF-09          ---------------------------------------g-gagctggag
                                                                         

Q13794_PMAIP1-01       ---------------cctgggaagaaggcgcgcaagaacgctcaaccgag
Q13794_PMAIP1-02       ---------------cctgggaagaaggcgcgcaagaacgctcaaccgag
O43521_BCL2L11-16      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-02      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-15      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-03      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-23      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-07      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-22      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-17      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-09      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-14      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-04      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-21      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-19      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-18      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-12      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-11      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-10      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-08      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-06      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-01      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-05      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
O43521_BCL2L11-13      ggtagacaattgcagcctgcggagaggcctccccag--------ctcaga
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-06         gagcgccatggcccgcgcacgccaggagggcagctc--------cccgga
B4DQK3_BBC3-01         gagcgccatggcccgcgcacgccaggagggcagctc--------cccgga
Q9BXH1_BBC3-03         -------atggcccgcgcacgccaggagggcagctc--------cccgga
B4DZQ9_BAD-01          gac-------tccagctctgcagagaggggcctggg--------ccccag
Q96LC9_BMF-05          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-07          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-06          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-01          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-02          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-03          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-04          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-08          gatgatgtgttccaaccagaggatggggagccggtg--------acccaa
Q96LC9_BMF-09          gatgat--------------------------------------------
                                                                         

Q13794_PMAIP1-01       ccccgcgcgggctcc--------------------------agcag----
Q13794_PMAIP1-02       ccccgcgcgggctcc--------------------------agcaggacc
O43521_BCL2L11-16      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-02      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-15      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-03      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-23      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-07      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-22      cct----ggggcccctacctc--------------cctacagacagagcc
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-17      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-09      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-14      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-04      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-21      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-19      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-18      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-12      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-11      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-10      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-08      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-06      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-01      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-05      cct----ggggcccctacctc--------------cctacagacagagcc
O43521_BCL2L11-13      cct----ggggcccctacctc--------------cctacagacagagcc
Q9BXH1_BBC3-04         ----gcatggggtctgcccaggcatgtcc-------------------at
Q9BXH1_BBC3-05         ----gcatggggtctgcccaggcatgtcc-------------------at
Q9BXH1_BBC3-06         gcccgtagagggcctggcccgcgacggcccgcgccccttcccgctcggcc
B4DQK3_BBC3-01         gcccgtagagggcctggcccgcgacggcccgcgccccttcccgctcggcc
Q9BXH1_BBC3-03         gcccgtagagggcctggcccgcgacggcccgcgccccttcccgctcggcc
B4DZQ9_BAD-01          ccccgcaggggacgggccctc-------------------aggct---cc
Q96LC9_BMF-05          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-07          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-06          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-01          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-02          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-03          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-04          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-08          ccc----gggagcttgctctctgctgacctgtttgcccagagccta--ct
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       ggcgggtacggcgggtacggcgagggacca--------------------
O43521_BCL2L11-16      acaag---------------------------------------------
O43521_BCL2L11-02      acaag---------------------------------------------
O43521_BCL2L11-15      acaag---------------------------------------------
O43521_BCL2L11-03      acaag---------------------------------------------
O43521_BCL2L11-23      acaag---------------------------------------------
O43521_BCL2L11-07      acaag---------------------------------------------
O43521_BCL2L11-22      acaag---------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      acaag---------------------------------------------
O43521_BCL2L11-17      acaag---------------------------------------------
O43521_BCL2L11-09      acaag---------------------------------------------
O43521_BCL2L11-14      acaag---------------------------------------------
O43521_BCL2L11-04      acaag---------------------------------------------
O43521_BCL2L11-21      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-19      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-18      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-12      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-11      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-10      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-08      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-06      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-01      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-05      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
O43521_BCL2L11-13      acaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgccccc
Q9BXH1_BBC3-04         gccaggtgcccagg----------gctgcttccacga-------------
Q9BXH1_BBC3-05         gccaggtgcccagg----------gctgcttccacga-------------
Q9BXH1_BBC3-06         gcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggct
B4DQK3_BBC3-01         gcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggct
Q9BXH1_BBC3-03         gcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggct
B4DZQ9_BAD-01          ggcaagcatcatcgccaggccccaggc-ctcctgtgggac----------
Q96LC9_BMF-05          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-07          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-06          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-01          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-02          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-03          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-04          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-08          ggactgccccctcagccgacttcagct-cttc------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-19      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-18      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-12      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-11      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-10      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-08      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-06      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-01      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-05      acggcagccctcagggcccgctggccccacctgccagccctggccctttt
O43521_BCL2L11-13      acggcagccctcagggcccgctggccccacctgccagccctggccc----
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-06         gccgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccc
B4DQK3_BBC3-01         gccgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccc
Q9BXH1_BBC3-03         gccgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccc
B4DZQ9_BAD-01          -------------------gccagtcaccagcaggagcagcc--------
Q96LC9_BMF-05          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-07          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-06          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-01          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-02          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-03          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-04          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-08          --------------------cctctcacccactgctgtggccctggcctt
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       -----------------------------------------------agc
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-19      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-18      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-12      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-11      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-10      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-08      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-06      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-01      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-05      gctaccagatccccgcttttcatctttatgagaagatcctccctgctgtc
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         ------------------------------------------------cg
Q9BXH1_BBC3-05         ------------------------------------------------cg
Q9BXH1_BBC3-06         caccgccccacccgccgtcaccgccgccctggggggttcccgctggcctg
B4DQK3_BBC3-01         caccgccccacccgccgtcaccgccgccctggggggttcccgctggcctg
Q9BXH1_BBC3-03         caccgccccacccgccgtcaccgccgccctggggggttcccgctggcctg
B4DZQ9_BAD-01          --aaccagcagcagccatcatggaggcgctgggg-------------ctg
Q96LC9_BMF-05          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-07          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-06          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-01          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-02          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-03          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-04          cgacccaccagc------caggaagac---aaag-------------cta
Q96LC9_BMF-08          cgac----------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       cggatttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcc
O43521_BCL2L11-16      -----------------tctcactctgtcacccaggctggagt---gcac
O43521_BCL2L11-02      -----------------------------------acaggagcccagcac
O43521_BCL2L11-15      -----------------------------------acaggagcccagcac
O43521_BCL2L11-03      -----------------------------------acaggagcccagcac
O43521_BCL2L11-23      -----------------------------------acaggagcccagcac
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      -----------------------------------acaggagcccagcac
O43521_BCL2L11-09      -----------------------------------acaggagcccagcac
O43521_BCL2L11-14      -----------------------------------acaggagcccagcac
O43521_BCL2L11-04      -----------------------------------acaggagcccagcac
O43521_BCL2L11-21      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-19      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-18      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-12      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-11      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-10      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-08      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-06      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-01      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-05      tcgatcctccagtgggtatttctcttttgacacagacaggagcccagcac
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         tgggtcccct--gccagatttg----------------------------
Q9BXH1_BBC3-05         tgggtcccct--gccagatttg---------------tggtcctcagccc
Q9BXH1_BBC3-06         ggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccc
B4DQK3_BBC3-01         ggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccc
Q9BXH1_BBC3-03         ggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccc
B4DZQ9_BAD-01          tggagatccggagtcgccacagctcctaccccgcgg--ggacggaggacg
Q96LC9_BMF-05          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-07          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-06          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-01          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-02          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-03          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-04          cccagactc----tcagcccagcctcccccagccaa--ggtgtcatgctg
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       tttcctcctctctttcctcctcgccacttgcccttccccggggccacgag
O43521_BCL2L11-16      tggtgcgatct--tggctcactgc-----------------------aac
O43521_BCL2L11-02      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-15      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-03      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-23      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-09      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-14      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-04      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-21      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-19      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-18      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-12      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-11      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-10      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-08      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-06      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-01      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-05      ccatgagttgtgacaaatcaacac-----------------------aaa
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         tcgctctcgctggcggagcagcac-------------ctggagtcgcccg
Q9BXH1_BBC3-06         tcgctctcgctggcggagcagcac-------------ctggagtcgcccg
B4DQK3_BBC3-01         tcgctctcgctggcggagcagcac-------------ctggagtcgcccg
Q9BXH1_BBC3-03         tcgctctcgctggcggagcagcac-------------ctggagtcgcccg
B4DZQ9_BAD-01          ac-gaagggatgggggaggagccc-----agcccctttcggggccgttcg
Q96LC9_BMF-05          ccttgtggggtgactgaggaaccccagcgactcttttatg----------
Q96LC9_BMF-07          ccttgtggggtgactgaggaaccccagcgactcttttatg----------
Q96LC9_BMF-06          ccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctgg
Q96LC9_BMF-01          ccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctgg
Q96LC9_BMF-02          ccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctgg
Q96LC9_BMF-03          ccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctgg
Q96LC9_BMF-04          ccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctgg
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------agctggaagtcgagtgtgctactcaactcaggagat
Q13794_PMAIP1-02       gaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagat
O43521_BCL2L11-16      ctccaactcccaagttcaagcggtt---ctcctgcctcag----------
O43521_BCL2L11-02      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggta
O43521_BCL2L11-15      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggta
O43521_BCL2L11-03      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg--
O43521_BCL2L11-23      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgg--
O43521_BCL2L11-07      ------------------------------------------------ct
O43521_BCL2L11-22      ------------------------------------------------ct
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      ------------------------------------------------ct
O43521_BCL2L11-17      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtt
O43521_BCL2L11-09      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-14      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-04      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-21      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-19      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-18      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtt
O43521_BCL2L11-12      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggt
O43521_BCL2L11-11      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-10      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-08      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-06      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtt
O43521_BCL2L11-01      ccccaagtcctccttgccagg-----------------------------
O43521_BCL2L11-05      ccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggct
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         tgcccagcgccccgggggctctggc----gggcggtcccacccaggcggc
Q9BXH1_BBC3-06         tgcccagcgccccgggggctctggc----gggcggtcccacccaggcggc
B4DQK3_BBC3-01         tgcccagcgccccgggggctctggc----gggcggtcccacccaggcggc
Q9BXH1_BBC3-03         tgcccagcgccccgggggctctggc----gggcggtcccacccaggcggc
B4DZQ9_BAD-01          cgctcggcgcccc-------ccaacctctgggcagcacagcgctatggcc
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-06          ctatcggcttcctctccctgccagtttcccagcagtcttgcccattgggg
Q96LC9_BMF-01          ctatcggcttcctctccctgccagtttcccagcagtcttgcccattgggg
Q96LC9_BMF-02          ctatcggcttcctctccctgccagtttcccagcagtcttgcccattgggg
Q96LC9_BMF-03          ctatcggcttcctctccctgccagtttcccagcagtcttgcccattgggg
Q96LC9_BMF-04          ctatcggcttcctctccctgccagtttcccagcagtcttgcccattgggg
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       ttg-----------------------------------------------
Q13794_PMAIP1-02       ttg-----------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      gtcatccta-----------------------------------------
O43521_BCL2L11-15      gtcatccta-----------------------------------------
O43521_BCL2L11-03      ---at---------------------------------------------
O43521_BCL2L11-23      ---at---------------------------------------------
O43521_BCL2L11-07      tccat---------------------------------------------
O43521_BCL2L11-22      tccat---------------------------------------------
Q6JTU4_BCL2L11-01      ---at---------------------------------------------
O43521_BCL2L11-20      tccat---------------------------------------------
O43521_BCL2L11-17      agaga---------------------------------------------
O43521_BCL2L11-09      tccat---------------------------------------------
O43521_BCL2L11-14      tccat---------------------------------------------
O43521_BCL2L11-04      tccat---------------------------------------------
O43521_BCL2L11-21      aactg---------------------------------------------
O43521_BCL2L11-19      tccat---------------------------------------------
O43521_BCL2L11-18      agaga---------------------------------------------
O43521_BCL2L11-12      atttt---------------------------------------------
O43521_BCL2L11-11      tccat---------------------------------------------
O43521_BCL2L11-10      tccat---------------------------------------------
O43521_BCL2L11-08      aactg---------------------------------------------
O43521_BCL2L11-06      agaga---------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      tccat---------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         --------------------------------------------------
Q9BXH1_BBC3-05         cccgggagtccgcggggaggaggaacagtgggcccggg----agatcggg
Q9BXH1_BBC3-06         cccgggagtccgcggggaggaggaacagtgggcccggg----agatcggg
B4DQK3_BBC3-01         cccgggagtccgcggggaggaggaacagtgggcccggg----agatcggg
Q9BXH1_BBC3-03         cccgggagtccgcggggaggaggaacagtgggcccggg----agatcggg
B4DZQ9_BAD-01          gcgagctcc-----------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-06          agcagccccccgaagggcagtggcaacatcaagcagag------------
Q96LC9_BMF-01          agcagccccccgaagggcagtggcaacatcaagcagaggtacagattgcc
Q96LC9_BMF-02          agcagccccccgaagggcagtggcaacatcaagcagaggtacagattgcc
Q96LC9_BMF-03          agcagccccccgaagggcagtggcaacatcaagcagaggtacagattgcc
Q96LC9_BMF-04          agcagccccccgaagggcagtggcaacatcaagcagaggtacagattgcc
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       --------------------------------------------------
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      -----------------------------------------------gag
O43521_BCL2L11-15      -----------------------------------------------gag
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      --------------------------------------------------
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         -------------------------------------------------t
Q9BXH1_BBC3-05         gcccagctgcggcggatggcggacgacctcaacgcacagtacgagcggcg
Q9BXH1_BBC3-06         gcccagctgcggcggatggcggacgacctcaacgcacagtacgagcggcg
B4DQK3_BBC3-01         gcccagctgcggcggatggcggacgacctcaacgcacagtacgagcggcg
Q9BXH1_BBC3-03         gcccagctgcggcggatggcggacgacctcaacgcacagtacgagcggcg
B4DZQ9_BAD-01          --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
Q96LC9_BMF-01          cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagca
Q96LC9_BMF-02          cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagca
Q96LC9_BMF-03          cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagca
Q96LC9_BMF-04          cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagca
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       gagacaaactgaacttccggcagaaacttctgaatctgatatccaaactc
Q13794_PMAIP1-02       gagacaaactgaacttccggcagaaacttctgaatctgatatccaaactc
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      gatatagg-tgatctttca-----------ctgtgctttggatttatatt
O43521_BCL2L11-15      gatatagg-tgatctttca-----------ctgtgctttggatttatatt
O43521_BCL2L11-03      gactccgctggatcct----------------------------------
O43521_BCL2L11-23      gactccgctggatcct----------------------------------
O43521_BCL2L11-07      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-22      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
Q6JTU4_BCL2L11-01      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-20      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-17      aatagagg------------------------------------------
O43521_BCL2L11-09      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-14      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-04      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-21      ggactag-------------------------------------------
O43521_BCL2L11-19      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-18      aatagaggaagttgtcgtg-----------tag-----------------
O43521_BCL2L11-12      tgaataa-------------------------------------------
O43521_BCL2L11-11      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-10      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-08      ggactag-------------------------------------------
O43521_BCL2L11-06      aatagaggaagttgtcgtg-----------tag-----------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      gaggcaggctgaacctgca-----------gatatgcgcccagagatatg
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         gagacaagaggagcagcag-----------cggcaccg----------cc
Q9BXH1_BBC3-05         gagacaagaggagcagcag-----------cggcaccg----------cc
Q9BXH1_BBC3-06         gagacaagaggagcagcag-----------cggcaccg----------cc
B4DQK3_BBC3-01         gagacaagaggagcagcag-----------cggcaccg----------cc
Q9BXH1_BBC3-03         gagacaagaggagcagcag-----------cggcaccg----------cc
B4DZQ9_BAD-01          ------ggaggatgagtga-----------cgagtttgtgga--------
Q96LC9_BMF-05          -caccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-07          -caccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-06          -caccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-01          acaccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-02          acaccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-03          acaccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-04          acaccagcagaaccaaaat-----------cgtgtgtggtggcagatcct
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       ttctgctcagga-------------------------------------a
Q13794_PMAIP1-02       ttctgctcagga-------------------------------------a
O43521_BCL2L11-16      --cctcccaag--------------tag----------------------
O43521_BCL2L11-02      tactggcttagatttgtatggccaccaccat------------------a
O43521_BCL2L11-15      tactggcttagatttgtatggccaccaccat------------------a
O43521_BCL2L11-03      ----ccctcagaattgccctt----cat---------------------a
O43521_BCL2L11-23      ----ccctcagaattgccctt----cat---------------------a
O43521_BCL2L11-07      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-22      gatcgcccaagagttgcggcg----tattgg------------------a
Q6JTU4_BCL2L11-01      gatcgcccaagagttgcggcg----tatcgg------------------a
O43521_BCL2L11-20      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-17      ----------aagttgtcgtg----tag----------------------
O43521_BCL2L11-09      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-14      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-04      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-10      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      gatcgcccaagagttgcggcg----tattgg------------------a
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         cctcaccctggagggtcctgtacaatctcatcatgggactcctgccctta
Q9BXH1_BBC3-05         cctcaccctggagggtcctgtacaatctcatcatgggactcctgccctta
Q9BXH1_BBC3-06         cctcaccctggagggtcctgtacaatctcatcatgggactcctgccctta
B4DQK3_BBC3-01         cctcaccctggagggtcctgtacaatctcatcatgggactcctgccctta
Q9BXH1_BBC3-03         cctcaccctggagggtcctgtacaatctcatcatgggactcctgccctta
B4DZQ9_BAD-01          -ctcctttaagaagggactt-----cctcgcccgaaga-----------g
Q96LC9_BMF-05          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-07          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-06          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-01          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-02          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-03          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-04          cctcttcctgcacaaccttg-----ctttgaatggaga-----------a
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       cctga---------------------------------------------
Q13794_PMAIP1-02       cctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttttc
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      gtcaagatacagaacaactcaaccacaaggatttctcatga---------
O43521_BCL2L11-15      gtcaagatacagaacaactcaaccacaaggatttctcatga---------
O43521_BCL2L11-03      gggaagttcagtggccact----caagtggttagcaaaatcaagctaa--
O43521_BCL2L11-23      gggaagttcagtggccact----caagtggttagcaaaatcaagctaa--
O43521_BCL2L11-07      gacgagtttaacgcttactatgcaaggaggctggcaaaactcctggcatc
O43521_BCL2L11-22      gacgagtttaacgcttactatgcaaggaggctggcaaaactcctggcatc
Q6JTU4_BCL2L11-01      gacgagtttaacgcttactatgcaaggaggttagagaaatag--------
O43521_BCL2L11-20      gacgagtttaacgcttactatgcaaggaggatgcctcttccacctgatta
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      gacgagtttaacgcttactatgcaaggaggttagagaaatag--------
O43521_BCL2L11-14      gacgagtttaacgcttactatgcaaggaggttagagaaatag--------
O43521_BCL2L11-04      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      gacgagtttaacgcttactatgcaaggaggatgcctcttccacctgatta
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      gacgagtttaacgcttactatgcaaggaggatgcctcttccacctgatta
O43521_BCL2L11-10      gacgagtttaacgcttactatgcaaggaggttagagaaatag--------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      gacgagtttaacgcttactatgcaaggagggtatttttgaataattacca
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         cccaggggccacagagcccccgagatggagcccaattaggtgcctgcacc
Q9BXH1_BBC3-05         cccaggggccacagagcccccgagatggagcccaattag-----------
Q9BXH1_BBC3-06         cccaggggccacagagcccccgagatggagcccaattaggtgcctgcacc
B4DQK3_BBC3-01         cccaggggccacagagcccccgagatggagcccaattag-----------
Q9BXH1_BBC3-03         cccaggggccacagagcccccgagatggagcccaattag-----------
B4DZQ9_BAD-01          cgcgggcacagcaacgcagatgcggcaaagccc---caggcgcctgcgct
Q96LC9_BMF-05          ---gagaacaggaacg-------gggcaggccc---tag-----------
Q96LC9_BMF-07          ---gagaacaggaacg-------gggcaggccc---tag-----------
Q96LC9_BMF-06          ---gagaacaggaacg-------gggcaggccc---taggtga-------
Q96LC9_BMF-01          ---gagaacaggaacg-------gggcaggccc---taggtga-------
Q96LC9_BMF-02          ---gagaacaggaacg-------gggcaggccc---taggtga-------
Q96LC9_BMF-03          ---gagaacaggaacg-------gggcaggccc---taggtga-------
Q96LC9_BMF-04          ---gagaacaggaacg-------gggcaggccc---taggtga-------
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       --------------------------------------------------
Q13794_PMAIP1-02       tcaggaggtgcacgtttcatcaatttgaagaaagactgcattgtaattga
O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      ctccacctga----------------------------------------
O43521_BCL2L11-22      ctccacctga----------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      a-------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      agcagccgaagaccacccacgaatggttatcttacgactgttacgttaca
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      a-------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      a-------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      agcagccgaagaccacccacgaatggttatcttacgactgttacgttaca
O43521_BCL2L11-13      --------------------------------------------------
Q9BXH1_BBC3-04         cgcccggtggacgtcagggactcggggggcaggcccctcccacctcctga
Q9BXH1_BBC3-05         --------------------------------------------------
Q9BXH1_BBC3-06         cgcccggtggacgtcagggactcggggggcaggcccctcccacctcctga
B4DQK3_BBC3-01         --------------------------------------------------
Q9BXH1_BBC3-03         --------------------------------------------------
B4DZQ9_BAD-01          aa------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-08          --------------------------------------------------
Q96LC9_BMF-09          --------------------------------------------------
                                                                         

Q13794_PMAIP1-01       ----------------------------------------
Q13794_PMAIP1-02       ----------------------------------------
O43521_BCL2L11-16      ----------------------------------------
O43521_BCL2L11-02      ----------------------------------------
O43521_BCL2L11-15      ----------------------------------------
O43521_BCL2L11-03      ----------------------------------------
O43521_BCL2L11-23      ----------------------------------------
O43521_BCL2L11-07      ----------------------------------------
O43521_BCL2L11-22      ----------------------------------------
Q6JTU4_BCL2L11-01      ----------------------------------------
O43521_BCL2L11-20      ----------------------------------------
O43521_BCL2L11-17      ----------------------------------------
O43521_BCL2L11-09      ----------------------------------------
O43521_BCL2L11-14      ----------------------------------------
O43521_BCL2L11-04      ttgtccgcctggtgtggagaatgcattga-----------
O43521_BCL2L11-21      ----------------------------------------
O43521_BCL2L11-19      ----------------------------------------
O43521_BCL2L11-18      ----------------------------------------
O43521_BCL2L11-12      ----------------------------------------
O43521_BCL2L11-11      ----------------------------------------
O43521_BCL2L11-10      ----------------------------------------
O43521_BCL2L11-08      ----------------------------------------
O43521_BCL2L11-06      ----------------------------------------
O43521_BCL2L11-01      ----------------------------------------
O43521_BCL2L11-05      ttgtccgcctggtgtggagaatgcattga-----------
O43521_BCL2L11-13      ----------------------------------------
Q9BXH1_BBC3-04         caccctggccagcgcgggggactttctctgcaccatgtag
Q9BXH1_BBC3-05         ----------------------------------------
Q9BXH1_BBC3-06         caccctggccagcgcgggggactttctctgcaccatgtag
B4DQK3_BBC3-01         ----------------------------------------
Q9BXH1_BBC3-03         ----------------------------------------
B4DZQ9_BAD-01          ----------------------------------------
Q96LC9_BMF-05          ----------------------------------------
Q96LC9_BMF-07          ----------------------------------------
Q96LC9_BMF-06          ----------------------------------------
Q96LC9_BMF-01          ----------------------------------------
Q96LC9_BMF-02          ----------------------------------------
Q96LC9_BMF-03          ----------------------------------------
Q96LC9_BMF-04          ----------------------------------------
Q96LC9_BMF-08          ----------------------------------------
Q96LC9_BMF-09          ----------------------------------------
                                                               

© 1998-2022Legal notice