Dataset for CDS BAD of organism Heterocephalus glaber

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G5B6Q3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Heterocephalus glaber GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctccgaagagagggccctgggccccacccccac
aggggaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagaggcagctgatcagcagca
gacaccatggaggcactggggctacggagacccggagtcgccacagctcataccccacggggatggaggaggaggcgggg
atgaaggaggagcccagtccattccggggccgctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcag
agagctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagcgcgggcacagcgacga
agctgtggcagagctccagttggacacgcgccatccagtcctggtgggatcggaacttgggaagaggaggctccgccccc
tctcagtga
>gnl|bcl2dbcds|G5B6Q3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Heterocephalus glaber GN=BAD (length=585 residues).
atgcggactccagagaacccctcacccgctcctacaaatgccgaaggattaaggaagttggagctggggatccggagact
tgagtcagcccagagcatgttccagatcccagagtttgagccaagtgagcaggaagactccagctccgaagagagggccc
tgggccccacccccacaggggaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagagg
cagctgatcagcagcagacaccatggaggcactggggctacggagacccggagtcgccacagctcataccccacggggat
ggaggaggaggcggggatgaaggaggagcccagtccattccggggccgctcacgctcagcgcctcccaatctctgggctg
cacagcgctatggcagagagctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagc
gcgggcacagcgacgaagctgtggcagagctccagttggacacgcgccatccagtcctggtgggatcggaacttgggaag
aggaggctccgccccctctcagtga
© 1998-2020Legal notice