Dataset for CDS BAD of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G5B6Q3_BAD-02      ------------------------------------------------------------
G5B6Q3_BAD-01      atgcggactccagagaacccctcacccgctcctacaaatgccgaaggattaaggaagttg
                                                                               

G5B6Q3_BAD-02      ------------------------------------atgttccagatcccagagtttgag
G5B6Q3_BAD-01      gagctggggatccggagacttgagtcagcccagagcatgttccagatcccagagtttgag
                                                       ************************

G5B6Q3_BAD-02      ccaagtgagcaggaagactccagctccgaagagagggccctgggccccacccccacaggg
G5B6Q3_BAD-01      ccaagtgagcaggaagactccagctccgaagagagggccctgggccccacccccacaggg
                   ************************************************************

G5B6Q3_BAD-02      gaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagagg
G5B6Q3_BAD-01      gaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagagg
                   ************************************************************

G5B6Q3_BAD-02      cagctgatcagcagcagacaccatggaggcactggggctacggagacccggagtcgccac
G5B6Q3_BAD-01      cagctgatcagcagcagacaccatggaggcactggggctacggagacccggagtcgccac
                   ************************************************************

G5B6Q3_BAD-02      agctcataccccacggggatggaggaggaggcggggatgaaggaggagcccagtccattc
G5B6Q3_BAD-01      agctcataccccacggggatggaggaggaggcggggatgaaggaggagcccagtccattc
                   ************************************************************

G5B6Q3_BAD-02      cggggccgctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagagag
G5B6Q3_BAD-01      cggggccgctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagagag
                   ************************************************************

G5B6Q3_BAD-02      ctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagc
G5B6Q3_BAD-01      ctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagc
                   ************************************************************

G5B6Q3_BAD-02      gcgggcacagcgacgaagctgtggcagagctccagttggacacgcgccatccagtcctgg
G5B6Q3_BAD-01      gcgggcacagcgacgaagctgtggcagagctccagttggacacgcgccatccagtcctgg
                   ************************************************************

G5B6Q3_BAD-02      tgggatcggaacttgggaagaggaggctccgccccctctcagtga
G5B6Q3_BAD-01      tgggatcggaacttgggaagaggaggctccgccccctctcagtga
                   *********************************************

© 1998-2020Legal notice