Dataset for CDS BAD of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G5B6Q3_BAD-01      atgcggactccagagaacccctcacccgctcctacaaatgccgaaggattaaggaagttg
G5B6Q3_BAD-02      ------------------------------------------------------------

G5B6Q3_BAD-01      gagctggggatccggagacttgagtcagcccagagcatgttccagatcccagagtttgag
G5B6Q3_BAD-02      ------------------------------------atgttccagatcccagagtttgag

G5B6Q3_BAD-01      ccaagtgagcaggaagactccagctccgaagagagggccctgggccccacccccacaggg
G5B6Q3_BAD-02      ccaagtgagcaggaagactccagctccgaagagagggccctgggccccacccccacaggg

G5B6Q3_BAD-01      gaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagagg
G5B6Q3_BAD-02      gaccggctaggccccagttcaccaggaggcttcctgggagacatcagtcaccagcagagg

G5B6Q3_BAD-01      cagctgatcagcagcagacaccatggaggcactggggctacggagacccggagtcgccac
G5B6Q3_BAD-02      cagctgatcagcagcagacaccatggaggcactggggctacggagacccggagtcgccac

G5B6Q3_BAD-01      agctcataccccacggggatggaggaggaggcggggatgaaggaggagcccagtccattc
G5B6Q3_BAD-02      agctcataccccacggggatggaggaggaggcggggatgaaggaggagcccagtccattc

G5B6Q3_BAD-01      cggggccgctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagagag
G5B6Q3_BAD-02      cggggccgctcacgctcagcgcctcccaatctctgggctgcacagcgctatggcagagag

G5B6Q3_BAD-01      ctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagc
G5B6Q3_BAD-02      ctccggaggatgagcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagc

G5B6Q3_BAD-01      gcgggcacagcgacgaagctgtggcagagctccagttggacacgcgccatccagtcctgg
G5B6Q3_BAD-02      gcgggcacagcgacgaagctgtggcagagctccagttggacacgcgccatccagtcctgg

G5B6Q3_BAD-01      tgggatcggaacttgggaagaggaggctccgccccctctcagtga
G5B6Q3_BAD-02      tgggatcggaacttgggaagaggaggctccgccccctctcagtga

© 1998-2020Legal notice