Dataset for CDS classical BH3-containing proteins of organism Gopherus evgoodei

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C4VJX6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL2L11 (length=609 residues).
atgaagcagacgcgtcgcgatcggggtttggccaggggcgggagctgggcttggtggcggtggcgggtcggcgctctccg
cagtgcctggataaacagcccggcgctccggcgggggtggctgtgcccgcgctgggggggatttcacaggcatgtggcgc
ttggccgcaggcaggaaaaagaccaaatggcaaagcaaccttctgatctaaattcagagtgcgacagagaaggtggacag
tttcagtcaactgaaaggccaagtcaacctcagcatcttagacctggggcccctacctctatacaaacacagtatcaaga
caggagtcctgcgcctatgagttgcgacaagtccacgcagactccaagtcccccttgtcaagcctttaatcattatctaa
gtgcaatggcttccaggtgggagtctccctcaatacgtgaagacatgcagccggaaatatggattgcacaggaactgcgg
cgtattggagatgagtttaatgcttcctattgcccaagaaggggtttcttggataatccagcagtaaaccaccaaattgt
tttgcgcctgttacgttatatcatccgcctcatttggagactgcagtaa
>gnl|bcl2dbcds|A0A8C4VJX6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL2L11 (length=519 residues).
atgaagcagacgcgtcgcgatcggggtttggccaggggcgggagctgggcttggtggcggtggcgggtcggcgctctccg
cagtgcctggataaacagcccggcgctccggcgggggtggctgtgcccgcgctgggggggatttcacaggcatgtggcgc
ttggccgcaggcaggaaaaagaccaaatggcaaagcaaccttctgatctaaattcagagtgcgacagagaaggtggacag
tttcagtcaactgaaaggccaagtcaacctcagcatcttagacctggggcccctacctctatacaaacacagtatcaagc
ttccaggtgggagtctccctcaatacgtgaagacatgcagccggaaatatggattgcacaggaactgcggcgtattggag
atgagtttaatgcttcctattgcccaagaaggggtttcttggataatccagcagtaaaccaccaaattgttttgcgcctg
ttacgttatatcatccgcctcatttggagactgcagtaa
>gnl|bcl2dbcds|A0A8C4W1J6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gopherus evgoodei GN=BMF (length=579 residues).
atggatccccccaactacctggaagacgactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttccccctcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttctactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccgcacctccaagaggagcctcgggaaggtcagcggg
aagcacttgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctctttatacataacttggccttaaatgtggaggtgaacaggaa
ccacgtaggtcagaggtga
>gnl|bcl2dbcds|A0A8C4WLZ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gopherus evgoodei GN=BAD (length=426 residues).
atgtttcgcatccaggagttcccggacgaggtgttcccggggcgagggaaggaggcgcctgctccccccgagtcgcagcg
gggacacacgcccggctccaagcagccagacacccccacagctgaggtgcgaagccggatagggtcagacaccccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgttcacgctcagcaccccccatcctttgggctgct
atgcgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcactgcaggtgctgccacgccccaagagtgc
aggcacgacatcccagctccaccgggggaacagctggaaagagaccctccaggcctggttggggcacagacccacccgtg
atgccctccccaggagctccaagtga
>gnl|bcl2dbcds|A0A8C4WNF3_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gopherus evgoodei GN=PMAIP1 (length=141 residues).
atgactggttttcctttgtgttttacagcacaggaagctgtgacgcagtgctctttgcaactacgcaaaataggagatat
atgcaacctgcagcagaagattcttaacgttattacaaaactgttctgcccaggaacgtga
© 1998-2022Legal notice