Dataset for CDS classical BH3-containing proteins of organism Gopherus evgoodei

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4WLZ6_BAD-01       atgtttcgcatccaggagttcccggacgaggtgtt--cccggggcgagg-
A0A8C4VJX6_BCL2L11      atgaagcagacgcgtcgc------gatcggggtttggccaggggcgggag
A0A8C4VJX6_BCL2L11      atgaagcagacgcgtcgc------gatcggggtttggccaggggcgggag
A0A8C4W1J6_BMF-01       atggatccccccaactacctggaagacgactattccagcctggacgggc-
A0A8C4WNF3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C4WLZ6_BAD-01       -----------gaaggaggcgcct----gctcccccc--------gagtc
A0A8C4VJX6_BCL2L11      ctgggcttggtggcggtggcgggtcggcgctctccgcagtgcctggataa
A0A8C4VJX6_BCL2L11      ctgggcttggtggcggtggcgggtcggcgctctccgcagtgcctggataa
A0A8C4W1J6_BMF-01       ---------tggacgatgacgtgt------ttcactctgactttggactc
A0A8C4WNF3_PMAIP1-      ---------------atgactggt------tttcctttgtgtt-----tt
                                         * *   *      *   *               

A0A8C4WLZ6_BAD-01       gcag------------------------------------cggggac---
A0A8C4VJX6_BCL2L11      acag-----------------------cccggcgctccggcgggggt---
A0A8C4VJX6_BCL2L11      acag-----------------------cccggcgctccggcgggggt---
A0A8C4W1J6_BMF-01       acaggtcagcctggtgagatgacccctcctggcattttcacacagaacca
A0A8C4WNF3_PMAIP1-      acag------------------------------------cacagga---
                         ***                                    *   *     

A0A8C4WLZ6_BAD-01       ---------------------------------------------acacg
A0A8C4VJX6_BCL2L11      -------ggctgtgcccgcgctgggggggatttcacag-------gcatg
A0A8C4VJX6_BCL2L11      -------ggctgtgcccgcgctgggggggatttcacag-------gcatg
A0A8C4W1J6_BMF-01       atcctacagctgtctc----ctggggaggtttcaactgttccccctcaca
A0A8C4WNF3_PMAIP1-      -------agctg---------------------------------tgacg
                                                                       *  

A0A8C4WLZ6_BAD-01       cccggct---------------------ccaagcagccagacacccccac
A0A8C4VJX6_BCL2L11      tggcgcttggccgcaggcaggaaaaagaccaaatggcaaagcaaccttct
A0A8C4VJX6_BCL2L11      tggcgcttggccgcaggcaggaaaaagaccaaatggcaaagcaaccttct
A0A8C4W1J6_BMF-01       cactgctgtggtccaggtatcaggcatgctgagcagcaggacaa---ggc
A0A8C4WNF3_PMAIP1-      cagtgct-------------------------------------------
                            ***                                           

A0A8C4WLZ6_BAD-01       agctgaggtgcgaagccggat--------------agggtcagacacccc
A0A8C4VJX6_BCL2L11      gatctaaattcagagtgcgac--------------agagaaggtggacag
A0A8C4VJX6_BCL2L11      gatctaaattcagagtgcgac--------------agagaaggtggacag
A0A8C4W1J6_BMF-01       aacccaaacactcagtccatcctcttctactcaggatgtcatgttgccat
A0A8C4WNF3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C4WLZ6_BAD-01       atctctggagccagaagtgcaggatgagccaggtggggcattccgggcac
A0A8C4VJX6_BCL2L11      tttcagtcaactgaaaggccaagtcaacctc--------------agcat
A0A8C4VJX6_BCL2L11      tttcagtcaactgaaaggccaagtcaacctc--------------agcat
A0A8C4W1J6_BMF-01       gtggagtcactgaagagccccagagactcttctatgggaatgctgggtac
A0A8C4WNF3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C4WLZ6_BAD-01       gttcacgctcagcaccccccatcctttgggct-gctatgcgttat-----
A0A8C4VJX6_BCL2L11      cttagacctggggcccctac---ctctatacaaacacagtatcaagacag
A0A8C4VJX6_BCL2L11      cttagacctggggcccctac---ctctatacaaacacagtatcaa-----
A0A8C4W1J6_BMF-01       cgtttacatgtccccccagttggctttgcattgaatccgcacc-------
A0A8C4WNF3_PMAIP1-      -----------------------ctttgca---actacgca---------
                                               ** *           *           

A0A8C4WLZ6_BAD-01       --------------------------------------------------
A0A8C4VJX6_BCL2L11      gagtcctgcgcctatgagttgcgacaagtccacgcagactccaagtcccc
A0A8C4VJX6_BCL2L11      --------------------------------------------------
A0A8C4W1J6_BMF-01       --------------------------------------------------
A0A8C4WNF3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C4WLZ6_BAD-01       -----------------------------------------gggcgggag
A0A8C4VJX6_BCL2L11      cttgtcaagcctttaatcattatctaagtgcaatggcttccaggtgggag
A0A8C4VJX6_BCL2L11      -----------------------------------gcttccaggtgggag
A0A8C4W1J6_BMF-01       ---------------------------------------tccaagaggag
A0A8C4WNF3_PMAIP1-      -----------------------------------------aaataggag
                                                                      ****

A0A8C4WLZ6_BAD-01       ctgcgcaggatgagtgacgagtttgatgtggcactgcaggt---------
A0A8C4VJX6_BCL2L11      tctccctcaatacgtgaagacatgcagccggaaatatggattgcacagga
A0A8C4VJX6_BCL2L11      tctccctcaatacgtgaagacatgcagccggaaatatggattgcacagga
A0A8C4W1J6_BMF-01       cctcgggaaggtcagcgggaagcacttgctgaggttcagattgcacggaa
A0A8C4WNF3_PMAIP1-      --------------------------------------------------
                                                                          

A0A8C4WLZ6_BAD-01       gctgccacgccccaagagtgcaggcacgacatcccag-------------
A0A8C4VJX6_BCL2L11      actgcggcgtattggagatgagtttaatgcttcctattgcccaagaaggg
A0A8C4VJX6_BCL2L11      actgcggcgtattggagatgagtttaatgcttcctattgcccaagaaggg
A0A8C4W1J6_BMF-01       gttacagtgcattgcagaccagttccacaggctccac-------------
A0A8C4WNF3_PMAIP1-      -----------------------------------at-------------
                                                           *              

A0A8C4WLZ6_BAD-01       ---------------ctccaccgggggaacagc-----------------
A0A8C4VJX6_BCL2L11      gtttcttggata---atccagcagtaaaccaccaaattgttttgcgcctg
A0A8C4VJX6_BCL2L11      gtttcttggata---atccagcagtaaaccaccaaattgttttgcgcctg
A0A8C4W1J6_BMF-01       ---------atacagaggcatcagcagaacagaaa--------tcaagtg
A0A8C4WNF3_PMAIP1-      ---------atatgcaacctgcagcaga----------------------
                                          *  * *   *                      

A0A8C4WLZ6_BAD-01       tggaaagagaccctccaggcctggttggggcacagacccacccgtgatgc
A0A8C4VJX6_BCL2L11      ttacgttatatcatcc--gcctcatttggagactgca-------------
A0A8C4VJX6_BCL2L11      ttacgttatatcatcc--gcctcatttggagactgca-------------
A0A8C4W1J6_BMF-01       tggtggcagatccttc--tcttta-tacataacttggccttaaatgtgga
A0A8C4WNF3_PMAIP1-      -------agattctta--acgttattacaaaactgttc------------
                               * *   *     * *   *     **                 

A0A8C4WLZ6_BAD-01       cctccccaggagctccaa---------gtga
A0A8C4VJX6_BCL2L11      ---------------------------gtaa
A0A8C4VJX6_BCL2L11      ---------------------------gtaa
A0A8C4W1J6_BMF-01       ggtgaacaggaaccacgtaggtcagaggtga
A0A8C4WNF3_PMAIP1-      --tgcccaggaac--------------gtga
                                                   ** *

© 1998-2022Legal notice