Dataset for CDS classical BH3-containing proteins of organism Ficedula albicollis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A803VLS8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L11 (length=159 residues).
atgttccataaggctgcagttcctgaggtgcagccggaggtctggatcgcgcaggagctgcggcgcatcggcgacgagtt
caatgcctcctattgtccccgcagggtaactcgaactttcccctctgcactccccactcctctcagagggaagggctga
>gnl|bcl2dbcds|A0A803WCD8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L11 (length=333 residues).
cgcagccgcgggccgggtcgggtcgggtcgggtcgggtcaggcacggccgtcgggcgctgcccgccgagcgcagccccgc
gcccgccctgggctgcgacaaggccacgcagacccccagcccgccctgccaggcgctcagccactgcctcagcgccatgg
gtaagctccggggcggctccccgtcctcctcctcctcctcctcctcctcctcgccgggctctgcttcctggctccccctc
ctcacctggcggggctttcctcagagccctgcgaaacgcggctcctctggggggtgtggaggggaagcgccgggggagac
gtgtaaagggtga
>gnl|bcl2dbcds|U3JS06_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ficedula albicollis GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagagggataacgggaatttacacagctga
© 1998-2022Legal notice