Dataset for CDS classical BH3-containing proteins of organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803WCD8_BCL2L11      ------cgcagccgcgggccgggtcgggtcgggtcgggtcgggtcaggca
A0A803VLS8_BCL2L11      atg-----------------------------------------------
U3JS06_BMF-01           atggatcgccccagctacctggaagaggactattctagcctggatgggct
                                                                          

A0A803WCD8_BCL2L11      cggccgtcgggcg-------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
U3JS06_BMF-01           ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                                                                          

A0A803WCD8_BCL2L11      --------------------------------------------------
A0A803VLS8_BCL2L11      --------------------------------------------------
U3JS06_BMF-01           gtgagatgactgcaactggctttttcacacagaaccagtcctacagctgc
                                                                          

A0A803WCD8_BCL2L11      ---------------------ctgcccgccgagcgcagccccgcgcccg-
A0A803VLS8_BCL2L11      ---------------------ttcc-------------------------
U3JS06_BMF-01           cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                                              * *                         

A0A803WCD8_BCL2L11      ---------ccctgggctgcg--acaaggccacgcagacccccagcccgc
A0A803VLS8_BCL2L11      -----------------------ataaggc--------------------
U3JS06_BMF-01           tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
                                               * *****                    

A0A803WCD8_BCL2L11      cct------gccagg--------------cgctcagccactgcctcagcg
A0A803VLS8_BCL2L11      -------------------------------tgcagttcctg---aggtg
U3JS06_BMF-01           cctcttccagtcaggatgttatgttgccttgtggagtcactg---aagag
                                                          **   ***     * *

A0A803WCD8_BCL2L11      ccatgggtaagctccggggcggctccccgtcctcctcctcctcctcctcc
A0A803VLS8_BCL2L11      -------------------------------------------------c
U3JS06_BMF-01           ccacggagactcttctatgggagtgctggttaccgtttacatgtccctcc
                                                                         *

A0A803WCD8_BCL2L11      tcctc---------------------------------------------
A0A803VLS8_BCL2L11      agccg---------------------------------------------
U3JS06_BMF-01           agctggctttgtgttggatccgcacctccaagaggaacctcaggaaggtc
                          *                                               

A0A803WCD8_BCL2L11      -------------------------------------ctcgccgggctct
A0A803VLS8_BCL2L11      -----------------gaggtctggatcgcgcaggagctgcggcgcatc
U3JS06_BMF-01           agcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcatt
                                                                ** * **   

A0A803WCD8_BCL2L11      gcttcctggctcccc---ctcctcac---------ctggcgg--------
A0A803VLS8_BCL2L11      ggcgacgagttcaat--gcctcctat-----tgtccccgcag--------
U3JS06_BMF-01           gccgaccagttccaccggctccacatacagaggcatcagcagaacagaaa
                        *    *  * **      *  *  *             ** *        

A0A803WCD8_BCL2L11      -----------gg---------ctttcctcagagccctgcgaaacgcggc
A0A803VLS8_BCL2L11      -----------ggtaactcgaactttccc-----ctctgcactcc-----
U3JS06_BMF-01           tcaagtgtggtggcagctt---tttctct-----tcctacacaacttggc
                                   **          **  *        ** *    *     

A0A803WCD8_BCL2L11      tcctctggggggtgtggaggggaagcgcc-------ggggga------ga
A0A803VLS8_BCL2L11      ------------------------ccactcctctcagaggga--------
U3JS06_BMF-01           cttaaacacggaggtgaacaggaaccacactgggcagagggataacggga
                                                 * *        * ****        

A0A803WCD8_BCL2L11      cgtgtaaagggtga
A0A803VLS8_BCL2L11      ------agggctga
U3JS06_BMF-01           atttacacagctga
                              *  * ***

© 1998-2022Legal notice