Dataset for CDS BCL2L11 of organism Ficedula albicollis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A803VLS8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L11 (length=159 residues).
atgttccataaggctgcagttcctgaggtgcagccggaggtctggatcgcgcaggagctgcggcgcatcggcgacgagtt
caatgcctcctattgtccccgcagggtaactcgaactttcccctctgcactccccactcctctcagagggaagggctga
>gnl|bcl2dbcds|A0A803WCD8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L11 (length=333 residues).
cgcagccgcgggccgggtcgggtcgggtcgggtcgggtcaggcacggccgtcgggcgctgcccgccgagcgcagccccgc
gcccgccctgggctgcgacaaggccacgcagacccccagcccgccctgccaggcgctcagccactgcctcagcgccatgg
gtaagctccggggcggctccccgtcctcctcctcctcctcctcctcctcctcgccgggctctgcttcctggctccccctc
ctcacctggcggggctttcctcagagccctgcgaaacgcggctcctctggggggtgtggaggggaagcgccgggggagac
gtgtaaagggtga
© 1998-2022Legal notice