Dataset for CDS BCL2L11 of organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803VLS8_BCL2L11      -----------------------------atgttccataaggc-------
A0A803WCD8_BCL2L11      cgcagccgcgggccgggtcgggtcgggtcgggtcgggtcaggcacggccg
                                                       **    * ****       

A0A803VLS8_BCL2L11      -----tgcagttcctgaggtgcagccggaggtctg---------------
A0A803WCD8_BCL2L11      tcgggcgctgcccgccgagcgcagccccgcgcccgccctgggctgcgaca
                              ** *  *     * ******    * * *               

A0A803VLS8_BCL2L11      -gatcgcgcag-----------gagctgc--ggcgcatcggcgacgagtt
A0A803WCD8_BCL2L11      aggccacgcagacccccagcccgccctgccaggcgc-tcagccactgcct
                         *  * *****           *  ****  ***** ** ** **    *

A0A803VLS8_BCL2L11      caatgcc-------------------------------------------
A0A803WCD8_BCL2L11      cagcgccatgggtaagctccggggcggctccccgtcctcctcctcctcct
                        **  ***                                           

A0A803VLS8_BCL2L11      tcctattgtccccgcaggg---taactcgaactttcccctctgcac----
A0A803WCD8_BCL2L11      cctcctcctcctcgccgggctctgcttcctggctccccctcctcacctgg
                         *   *  *** *** ***   *   **     * ******  ***    

A0A803VLS8_BCL2L11      --------tcccca------------------ctcctct--------cag
A0A803WCD8_BCL2L11      cggggctttcctcagagccctgcgaaacgcggctcctctggggggtgtgg
                                *** **                  *******          *

A0A803VLS8_BCL2L11      aggg---------------------aagggctga
A0A803WCD8_BCL2L11      aggggaagcgccgggggagacgtgtaaagggtga
                        ****                     ** ** ***

© 1998-2022Legal notice