Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-05 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=864 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaagtaggcatgggggcttggggcggggggagagtctgctggggctggggggccaggacctgcctcag
caactctgtctctgccaggctataccaggatatggtcccagagttttggcctcggctattatga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=591 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggacctcacc
aggaatgagggcctttgtcaaacactgttga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=450 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatgcaccagcaaaaccgccgtcgagtgtggt
ggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtgaggctgg
gctgccctcctcgcatggggcaccacaggaaggacatcagcgaggactga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=582 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaagtaggcatgggggcttggggcgggggg
agagtctgctggggctggggggccaggacctgcctcagcaactctgtctctgccaggctataccaggatatggtcccaga
gttttggcctcggctattatga
>gnl|bcl2dbcds|A0A5F5Y0M2_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=837 residues).
atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggctctgggaaggcccagggaggaggtgtggagc
ctccttgagcagtgaggcaggccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcgtttgtcatca
gtgtcgggccccacttcccccaggtagaagggaaaggagaaaggaaagggggagtccttcaggttcggccttcgggcagg
ggacagcaccccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgtgtggaggagctagaggatga
tgtgttccagccagaggatgtggagccggggacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
tggactgccccctcagccatctgcagctcttccctctcacccactgctgtggtcctgggcttcgacccaccagccaggaa
gacaaggccacccagaccctcagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccgaagaacccca
gcgactcttttatggcaacgctggctaccggctccctctccctgccagtttccctgcaggcttgccccttggtgagcagc
cccctgaagggcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccatcgg
cttcatatgcagcaacaccagcaaaaccgccgtcgagtgtggtggcagattctcctcttcctacacaacctggctttgaa
tgcagaagagaacaggaatggggcaggtcccaggtga
© 1998-2020Legal notice