Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5Y0M2_BMF-03      --------------------------------------------------
A0A5F5Y0M2_BMF-05      atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      --------------------------------------------------
                                                                         

A0A5F5Y0M2_BMF-03      --------------------------------------------------
A0A5F5Y0M2_BMF-05      ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      --------------------------------------------------
                                                                         

A0A5F5Y0M2_BMF-03      --------------------------------------------------
A0A5F5Y0M2_BMF-05      gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      --------------------------------------------------
                                                                         

A0A5F5Y0M2_BMF-03      --------------------------------------------------
A0A5F5Y0M2_BMF-05      tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      --------------------------------------------------
                                                                         

A0A5F5Y0M2_BMF-03      --------------------------------------------------
A0A5F5Y0M2_BMF-05      aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      --------------------------------------------------
                                                                         

A0A5F5Y0M2_BMF-03      --------------------------------atggagccgcctcagtgt
A0A5F5Y0M2_BMF-05      ccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgt
A0A5F5Y0M2_BMF-02      --------------------------------atggagccgcctcagtgt
A0A5F5Y0M2_BMF-01      --------------------------------atggagccgcctcagtgt
                                                       ******************

A0A5F5Y0M2_BMF-03      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A5F5Y0M2_BMF-05      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A5F5Y0M2_BMF-02      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A5F5Y0M2_BMF-01      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
                       **************************************************

A0A5F5Y0M2_BMF-03      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A5F5Y0M2_BMF-05      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A5F5Y0M2_BMF-02      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A5F5Y0M2_BMF-01      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
                       **************************************************

A0A5F5Y0M2_BMF-03      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A5F5Y0M2_BMF-05      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A5F5Y0M2_BMF-02      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A5F5Y0M2_BMF-01      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
                       **************************************************

A0A5F5Y0M2_BMF-03      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A5F5Y0M2_BMF-05      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A5F5Y0M2_BMF-02      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A5F5Y0M2_BMF-01      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
                       **************************************************

A0A5F5Y0M2_BMF-03      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A5F5Y0M2_BMF-05      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A5F5Y0M2_BMF-02      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A5F5Y0M2_BMF-01      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
                       **************************************************

A0A5F5Y0M2_BMF-03      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
A0A5F5Y0M2_BMF-05      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
A0A5F5Y0M2_BMF-02      aagaaccccagcgactcttttatg--------------------------
A0A5F5Y0M2_BMF-01      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
                       ************************                          

A0A5F5Y0M2_BMF-03      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A5F5Y0M2_BMF-05      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
                                                                         

A0A5F5Y0M2_BMF-03      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
A0A5F5Y0M2_BMF-05      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
A0A5F5Y0M2_BMF-02      --------------------------------------------------
A0A5F5Y0M2_BMF-01      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
                                                                         

A0A5F5Y0M2_BMF-03      ttgcagaccagttccatcggcttcatatg---------cagcaagtaggc
A0A5F5Y0M2_BMF-05      ttgcagaccagttccatcggcttcatatg---------cagcaagtaggc
A0A5F5Y0M2_BMF-02      -----------------------------------caccagcaaa-----
A0A5F5Y0M2_BMF-01      ttgcagaccagttccatcggcttcatatgcagcaacaccagcaaa-----
                                                             ******      

A0A5F5Y0M2_BMF-03      atgggggcttggggcggggggagagtctgctggggctggggggccaggac
A0A5F5Y0M2_BMF-05      atgggggcttggggcggggggagagtctgctggggctggggggccaggac
A0A5F5Y0M2_BMF-02      accgccgtcgagtgtggtggcagattctcct-------------------
A0A5F5Y0M2_BMF-01      accgccgtcgagtgtggtggcagattctcct-------------------
                       *  *  *    * * ** ** *** *** **                   

A0A5F5Y0M2_BMF-03      ctgcctcagcaactctgtctctgc---caggctataccaggatat-----
A0A5F5Y0M2_BMF-05      ctgcctcagcaactctgtctctgc---caggctataccaggatat-----
A0A5F5Y0M2_BMF-02      cttcctacacaac-ctggctttgaatgcagaagagaacagga-atggggc
A0A5F5Y0M2_BMF-01      cttcctacacaac-ctggctttgaatgcagaagagaacagga-atggggc
                       ** ***   **** *** ** **    ***   * * ***** **     

A0A5F5Y0M2_BMF-03      -ggtcccaga----------gttttggcctc-------------------
A0A5F5Y0M2_BMF-05      -ggtcccaga----------gttttggcctc-------------------
A0A5F5Y0M2_BMF-02      aggtcccaggtgaggctgggctgccctcctcgcatggggcaccacaggaa
A0A5F5Y0M2_BMF-01      aggtcccagg----------------acctcaccagga-------atgag
                        ********                  ****                   

A0A5F5Y0M2_BMF-03      ggctatta-----------tga
A0A5F5Y0M2_BMF-05      ggctatta-----------tga
A0A5F5Y0M2_BMF-02      ggacatcagcgaggac---tga
A0A5F5Y0M2_BMF-01      ggcctttgtcaaacactgttga
                       **   *             ***

© 1998-2020Legal notice