Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      atgaccagaaccagcccgggtcagaagaaaaggccaaggtgggagtggct
                                                                         

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      ctgggaaggcccagggaggaggtgtggagcctccttgagcagtgaggcag
                                                                         

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      gccacatttggggagggtgtcatcctcagtggtactttatcaccaggtcg
                                                                         

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      tttgtcatcagtgtcgggccccacttcccccaggtagaagggaaaggaga
                                                                         

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      --------------------------------------------------
A0A337ST43_BMF-05      aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
A0A337ST43_BMF-01      --------------------------------------------------
A0A337ST43_BMF-04      aaggaaagggggagtccttcaggttcggccttcgggcaggggacagcacc
                                                                         

A0A337ST43_BMF-02      --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-03      --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-05      ccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgt
A0A337ST43_BMF-01      --------------------------------atggagccgcctcagtgt
A0A337ST43_BMF-04      ccagatgcctgcattgcaccccagcaggggagatggagccgcctcagtgt
                                                       ******************

A0A337ST43_BMF-02      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A337ST43_BMF-03      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A337ST43_BMF-05      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A337ST43_BMF-01      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
A0A337ST43_BMF-04      gtggaggagctagaggatgatgtgttccagccagaggatgtggagccggg
                       **************************************************

A0A337ST43_BMF-02      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A337ST43_BMF-03      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A337ST43_BMF-05      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A337ST43_BMF-01      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
A0A337ST43_BMF-04      gacccagcctgggagcttgctgtctgctaacctgtttgcccagagccagc
                       **************************************************

A0A337ST43_BMF-02      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A337ST43_BMF-03      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A337ST43_BMF-05      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A337ST43_BMF-01      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
A0A337ST43_BMF-04      tggactgccccctcagccatctgcagctcttccctctcacccactgctgt
                       **************************************************

A0A337ST43_BMF-02      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A337ST43_BMF-03      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A337ST43_BMF-05      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A337ST43_BMF-01      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
A0A337ST43_BMF-04      ggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccct
                       **************************************************

A0A337ST43_BMF-02      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A337ST43_BMF-03      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A337ST43_BMF-05      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A337ST43_BMF-01      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
A0A337ST43_BMF-04      cagtccggcctccccgagtcagggtgtcatgctgccttgtggggtgaccg
                       **************************************************

A0A337ST43_BMF-02      aagaaccccagcgactcttttatg--------------------------
A0A337ST43_BMF-03      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
A0A337ST43_BMF-05      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
A0A337ST43_BMF-01      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
A0A337ST43_BMF-04      aagaaccccagcgactcttttatggcaacgctggctaccggctccctctc
                       ************************                          

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A337ST43_BMF-05      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A337ST43_BMF-01      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
A0A337ST43_BMF-04      cctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagg
                                                                         

A0A337ST43_BMF-02      --------------------------------------------------
A0A337ST43_BMF-03      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
A0A337ST43_BMF-05      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
A0A337ST43_BMF-01      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
A0A337ST43_BMF-04      gcattggcagcatcgagcagaggtacagattgcccgaaagcttcagtgca
                                                                         

A0A337ST43_BMF-02      -----------------------------------caccagcaaa-accg
A0A337ST43_BMF-03      ttgcagaccagttccatcggcttcatatgcagca-----agtaggcatgg
A0A337ST43_BMF-05      ttgcagaccagttccatcggcttcatatgcagca-----agtaggcatgg
A0A337ST43_BMF-01      ttgcagaccagttccatcggcttcatatgcagcaacaccagcaaa-accg
A0A337ST43_BMF-04      ttgcagaccagttccatcggcttcatatgcagcaacaccagcaaa-accg
                                                              ** *   *  *

A0A337ST43_BMF-02      ccgtcgagtgtggtggcagattctcct-------------------cttc
A0A337ST43_BMF-03      gggcttggggcggggggagagtctgctggggctggggggccaggacctgc
A0A337ST43_BMF-05      gggcttggggcggggggagagtctgctggggctggggggccaggacctgc
A0A337ST43_BMF-01      ccgtcgagtgtggtggcagattctcct-------------------cttc
A0A337ST43_BMF-04      ccgtcgagtgtggtggcagattctcct-------------------cttc
                         *    * * ** ** *** *** **                   ** *

A0A337ST43_BMF-02      ctacacaac-ctggctttgaatgcagaagagaacagga-atggggcaggt
A0A337ST43_BMF-03      ctcagcaactctgtctctgc---caggctataccaggatat------ggt
A0A337ST43_BMF-05      ctcagcaactctgtctctgc---caggctataccaggatat------ggt
A0A337ST43_BMF-01      ctacacaac-ctggctttgaatgcagaagagaacagga-atggggcaggt
A0A337ST43_BMF-04      ctacacaac-ctggctttgaatgcagaagagaacagga-atggggcaggt
                       **   **** *** ** **    ***   * * ***** **      ***

A0A337ST43_BMF-02      cccaggtgaggctgggctgccctcctcgcatggggcaccacaggaaggac
A0A337ST43_BMF-03      cccaga------------gtttt------------ggcctcgg-------
A0A337ST43_BMF-05      cccaga------------gtttt------------ggcctcgg-------
A0A337ST43_BMF-01      cccagg------------acctcaccaggaatgagggcctttg-------
A0A337ST43_BMF-04      cccagg--------------------------------------------
                       *****                                             

A0A337ST43_BMF-02      atcagcgaggactga
A0A337ST43_BMF-03      -cta-----ttatga
A0A337ST43_BMF-05      -cta-----ttatga
A0A337ST43_BMF-01      -tcaaacactgttga
A0A337ST43_BMF-04      ------------tga
                                   ***

© 1998-2020Legal notice