Dataset for CDS BAD of organism Esox lucius

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3P8Y761_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=501 residues).
atggaaaatattttcactatatcagacaccgaatctgaatcctcagatgtagaagaaaccaaaaaggaatggattgccgg
acaggggaagactggaagccgattaggcctctcccttaacctaccaggcgagggccggataaggttaaactctgaatctc
aggtcttcgctacatctggtggggagaggagcggggagctccagggtttggggcaagggttgaactgtgtggccacagaa
ggactaccttttagggtccgctcccagtcagcccccccggccctctgggctgccaagagatatggacggcagctgcgacg
catgagtgacgagttcgatacgtggctggataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatga
caacatccccgagctggtgggccttcctgttcagccacaaggaaactgagacagaaaagacccccaaccttatcattact
gaaccaagatcttctgagtag
>gnl|bcl2dbcds|A0A3P8Y761_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=576 residues).
atgggctgttccacaccctacagaaatgggatatcgacttctaccattctgcctcacaccacaggaaccggagataggct
cctgccctacgggctgttctgcctcataaccataggaactagagatggtacaggagcctatgggctgttctggcttagaa
acacacatatccacccactcatcctctgctctttttttataggcgagggccggataaggttaaactctgaatctcaggtc
ttcgctacatctggtggggagaggagcggggagctccagggtttggggcaagggttgaactgtgtggccacagaaggact
accttttagggtccgctcccagtcagcccccccggccctctgggctgccaagagatatggacggcagctgcgacgcatga
gtgacgagttcgatacgtggctggataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatgacaaca
tccccgagctggtgggccttcctgttcagccacaaggaaactgagacagaaaagacccccaaccttatcattactgaacc
aagatcttctgagtag
>gnl|bcl2dbcds|A0A3P8YI30_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=579 residues).
atgttttattcattttgtcactctccctgtgatgagtgtttcctaacaatatgtaatgcctttggtcagtgtttattaag
gatggatgttttttctcttcaggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacg
aaaaatatgatttggaccacttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaat
agaacactaccaggtgtacgcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacaga
gtttcaggttgcaatgactcctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctcccc
ctgcgctgtgggctgcaaaaaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggg
gagcccaagagaggaattatcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaagga
agctgaaggcagggactga
>gnl|bcl2dbcds|A0A3P8YI30_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
© 1998-2022Legal notice