Dataset for CDS BAD of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8Y761_BAD-01      atggaaaatattttcactatatcagacaccgaatc---tgaatcctcaga
A0A3P9A5G8_BAD-02      atgg----cttttaaaatggatcacactcaggattgtgtgggt-----ga
A0A3P9A5G8_BAD-01      atgg----cttttaaaatggatcacactcaggattgtgtgggt-----ga
                       ****      ***  * *  **** ** * * **    **  *     **

A0A3P8Y761_BAD-01      tgtagaagaaaccaaaaagga-----atggattgccggacaggggaa---
A0A3P9A5G8_BAD-02      cattccagaaaacataaacgaaaaatatgatttggaccacttaggaacta
A0A3P9A5G8_BAD-01      cattccagaaaacataaacgaaaaatatgatttggaccacttaggaacta
                         *   ***** ** *** **     ***  ***    **   ****   

A0A3P8Y761_BAD-01      ------gactggaagccgattaggcct-------ctcccttaac------
A0A3P9A5G8_BAD-02      cacattacccagaatt---tcagttctgtaatacctccactaatacaagc
A0A3P9A5G8_BAD-01      cacattacccagaatt---tcagttctgtaatacctccactaatacaagc
                               *  ***     * **  **       ****  ***       

A0A3P8Y761_BAD-01      ---------ctaccaggcgagggccggataaggttaaactctgaatctca
A0A3P9A5G8_BAD-02      aatagaacactaccaggtgta---cgcgtccggctctactcggaatccca
A0A3P9A5G8_BAD-01      aatagaacactaccaggtgta---cgcgtccggctctactcggaatccca
                                ******** *     **  *  ** *  **** ***** **

A0A3P8Y761_BAD-01      ggtcttcgctacatctggtggggagaggagcggggagctccagggtttgg
A0A3P9A5G8_BAD-02      ggtgtgttcccaggttggcagacaggacaacacagagtttcaggtt----
A0A3P9A5G8_BAD-01      ggtgtgttcccaggttggcagacaggacaacacagagtttcaggtt----
                       *** *   *      ***  *  **   * *   *** * **** *    

A0A3P8Y761_BAD-01      ggcaagggtt--------gaactgtgtggccacagaaggactacctttta
A0A3P9A5G8_BAD-02      -gcaatgactcctacggaggagagtgggggc---gatgcagcaccgttcc
A0A3P9A5G8_BAD-01      -gcaatgactcctacggaggagagtgggggc---gatgcagcaccgttcc
                        **** *  *        * *  *** ** *   ** * *  *** **  

A0A3P8Y761_BAD-01      gggtccgctcccagtcagcccccccggccctctgggctgccaagagatat
A0A3P9A5G8_BAD-02      ggggccggtcacagtctgctccccctgcgctgtgggctgcaaaaaaatat
A0A3P9A5G8_BAD-01      ggggccggtcacagtctgctccccctgcgctgtgggctgcaaaaaaatat
                       *** *** ** ***** ** ***** ** ** ******** ** * ****

A0A3P8Y761_BAD-01      ggacggcagctgcgacgcatgagtgacgagttcgatacgtggctggataa
A0A3P9A5G8_BAD-02      ggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaa
A0A3P9A5G8_BAD-01      ggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaa
                       **  * ****** *  * ******** ** ** ** ** ***** ** **

A0A3P8Y761_BAD-01      agggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatgacaa
A0A3P9A5G8_BAD-02      aggggagcccaagagaggaattatcccaggaagagcaaagcaggt--cta
A0A3P9A5G8_BAD-01      aggggagcccaagagaggaattatcccaggaagagcaaagcaggt--cta
                       **** *    *** * *  *  *   *****  *** ** *** *  * *

A0A3P8Y761_BAD-01      catccccgagctggtgggccttcctgttcagccacaaggaaactg-agac
A0A3P9A5G8_BAD-02      cag----aggatggttctcgttcctctggagtccaaaggaagctgaaggc
A0A3P9A5G8_BAD-01      cag----aggatggttctcgttcctctggagtccaaaggaagctgaaggc
                       **       * ****   * ***** *  ** *  ****** *** ** *

A0A3P8Y761_BAD-01      agaaaagacccccaaccttatcattactgaaccaagatcttctgagtag
A0A3P9A5G8_BAD-02      aggga------------------------------------ctga----
A0A3P9A5G8_BAD-01      aggga------------------------------------ctga----
                       **  *                                    ****    

© 1998-2020Legal notice