Dataset for CDS BAD of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9A5G8_BAD-01      atgttttattcattttgtcactctccctgtgatgagtgtttcctaacaat
A0A3P9A5G8_BAD-02      at------------------------------------------------
A0A3P8Y761_BAD-01      atgg-------------------------------------------aaa
A0A3P8Y761_BAD-02      atgggctgttc-------------------------cacaccctacagaa
                       **                                                

A0A3P9A5G8_BAD-01      atgtaatgcctttggtcagtgttt---------------attaaggatgg
A0A3P9A5G8_BAD-02      --------------------------------------------------
A0A3P8Y761_BAD-01      at---------attttcactatat------------cagacaccgaa---
A0A3P8Y761_BAD-02      atgggatatcgacttctaccattctgcctcacaccacaggaaccggagat
                                                                         

A0A3P9A5G8_BAD-01      atgttttttctcttcaggcttttaaaatggatcacactcaggattgtgtg
A0A3P9A5G8_BAD-02      ----------------ggcttttaaaatggatcacactcaggattgtgtg
A0A3P8Y761_BAD-01      ----------------------t---ctgaatcct---ca----------
A0A3P8Y761_BAD-02      aggctcctgccctacgggctgtt---ctgcctcataacca----------
                                             *    **  **     **          

A0A3P9A5G8_BAD-01      ggtgacattccagaaaacataaacgaaaaatatgatttggaccacttagg
A0A3P9A5G8_BAD-02      ggtgacattccagaaaacataaacgaaaaatatgatttggaccacttagg
A0A3P8Y761_BAD-01      ---gatgtagaagaaaccaaaaa-gga----atggattg-ccggacaggg
A0A3P8Y761_BAD-02      ---taggaactagagatggtaca-ggagcctatgggctgttctggcttag
                           *      *** *    * * * *    ***   **  *       *

A0A3P9A5G8_BAD-01      aactacacat---tacccagaatttcagttctgtaatacctccactaata
A0A3P9A5G8_BAD-02      aactacacat---tacccagaatttcagttctgtaatacctccactaata
A0A3P8Y761_BAD-01      gaagac---tggaagccga-----ttaggcct-------ctcccttaac-
A0A3P8Y761_BAD-02      aaacacacatatccaccca-----ctcatcct-------ctgctctttt-
                        *  **   *     ** *           **       ** *  *    

A0A3P9A5G8_BAD-01      caagcaatagaacactaccaggtgta---cgcgtccggctctactcggaa
A0A3P9A5G8_BAD-02      caagcaatagaacactaccaggtgta---cgcgtccggctctactcggaa
A0A3P8Y761_BAD-01      --------------ctaccaggcgagggccggataaggttaaactctgaa
A0A3P8Y761_BAD-02      --------------tttataggcgagggccggataaggttaaactctgaa
                                      *   *** *     **  *  ** *  **** ***

A0A3P9A5G8_BAD-01      tcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggt
A0A3P9A5G8_BAD-02      tcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggt
A0A3P8Y761_BAD-01      tctcaggtcttcgctacatctggtggggagaggagcggggagctccaggg
A0A3P8Y761_BAD-02      tctcaggtcttcgctacatctggtggggagaggagcggggagctccaggg
                       ** ***** *   *      ***  *  **   * *   *** * **** 

A0A3P9A5G8_BAD-01      t-----gcaatgactcctacggaggagagtgggggc---gatgcagcacc
A0A3P9A5G8_BAD-02      t-----gcaatgactcctacggaggagagtgggggc---gatgcagcacc
A0A3P8Y761_BAD-01      tttggggcaagggtt--------gaactgtgtggccacagaaggactacc
A0A3P8Y761_BAD-02      tttggggcaagggtt--------gaactgtgtggccacagaaggactacc
                       *     **** *  *        * *  *** ** *   ** * *  ***

A0A3P9A5G8_BAD-01      gttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaaaa
A0A3P9A5G8_BAD-02      gttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaaaa
A0A3P8Y761_BAD-01      ttttagggtccgctcccagtcagcccccccggccctctgggctgccaaga
A0A3P8Y761_BAD-02      ttttagggtccgctcccagtcagcccccccggccctctgggctgccaaga
                        **  *** *** ** ***** ** ***** ** ** ******** ** *

A0A3P9A5G8_BAD-01      aatatggctgccagctgaggaggatgagtgatgaatttgacacctggctt
A0A3P9A5G8_BAD-02      aatatggctgccagctgaggaggatgagtgatgaatttgacacctggctt
A0A3P8Y761_BAD-01      gatatggacggcagctgcgacgcatgagtgacgagttcgatacgtggctg
A0A3P8Y761_BAD-02      gatatggacggcagctgcgacgcatgagtgacgagttcgatacgtggctg
                        ******  * ****** *  * ******** ** ** ** ** ***** 

A0A3P9A5G8_BAD-01      gacaaaggggagcccaagagaggaattatcccaggaagagcaaagcaggt
A0A3P9A5G8_BAD-02      gacaaaggggagcccaagagaggaattatcccaggaagagcaaagcaggt
A0A3P8Y761_BAD-01      gataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagat
A0A3P8Y761_BAD-02      gataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagat
                       ** ****** *    *** * *  *  *   *****  *** ** *** *

A0A3P9A5G8_BAD-01      --ctacag----aggatggttctcgttcctctggagtccaaaggaagctg
A0A3P9A5G8_BAD-02      --ctacag----aggatggttctcgttcctctggagtccaaaggaagctg
A0A3P8Y761_BAD-01      gacaacatccccgagctggtgggccttcctgttcagccacaaggaaactg
A0A3P8Y761_BAD-02      gacaacatccccgagctggtgggccttcctgttcagccacaaggaaactg
                         * ***       * ****   * ***** *  ** *  ****** ***

A0A3P9A5G8_BAD-01      aaggcaggga------------------------------------ctga
A0A3P9A5G8_BAD-02      aaggcaggga------------------------------------ctga
A0A3P8Y761_BAD-01      -agacagaaaagacccccaaccttatcattactgaaccaagatcttctga
A0A3P8Y761_BAD-02      -agacagaaaagacccccaaccttatcattactgaaccaagatcttctga
                        ** ***  *                                    ****

A0A3P9A5G8_BAD-01      ----
A0A3P9A5G8_BAD-02      ----
A0A3P8Y761_BAD-01      gtag
A0A3P8Y761_BAD-02      gtag
                           

© 1998-2020Legal notice