Dataset for CDS classical BH3-containing proteins of organism Erpetoichthys calabaricus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C4REW7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L11 (length=627 residues).
atggcacgaccaccctcagatctaaattctgaaagtggcgcaggggatggtggaccattgcagcccacccaagaagcagg
tcgtcctctgagtagaccaggtccaaggacccattctgaaggtgaccaaagtggtgaagtgagccaacccgcacccaaca
gcctgcagggaggacttgctatgccccccagtccccatccttatgcctccaggtttccattgtttagttatttctcaagg
tcatccagtggatactattcttttgaatctggttctgtttccagcttgccatcaatgactgacaaattcacacagacgcc
aagtctttctagtcaagcaataagacatgcccagcagtggttagctcaagaatacgaacattatcaaggccatgacatgc
cacaggcttcatctggtcctaccagagctagacgctcctcaatgccagaagagatgcgaccagaagaaatggtggctcaa
gaactgcgacgaattggagacgatttcaacaatctatattttcaaaggggcatcggtggcaggaacaatggagcagaagc
cagtcgtcttcggtgggttattgtgtttgtgtggcgactttttgatattttaacaagatggcgttaa
>gnl|bcl2dbcds|A0A8C4REW7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L11 (length=618 residues).
atggcacgaccaccctcagatctaaattctgaaagtggcgcaggggatggtggaccattgcagcccacccaagaagcagg
tcgtcctctgagtagaccaggtccaaggacccattctgaaggtgaccaaagtggtgaagtgagccaacccgcacccaaca
gcctgcagggaggacttgctatgccccccagtccccatccttatgcctccaggtttccattgtttagttatttctcaagg
tcatccagtggatactattcttttgaatctggttctgtttccagcttgccatcaatgactgacaaattcacacagacgcc
aagtctttctagtcaagcaataagacatgcccagcagtggttagctcaagaatacgaacattatcaaggccatgacatgc
cacaggcttcatctggtcctaccagagctagacgctcctcaatgccagaagagatgcgaccagaagaaatggtggctcaa
gaactgcgacgaattggagacgatttcaacaatctatattttcaaagggtagccagggcctatccaggcagcgtttggag
aagggcaggaaccagctgtggacagggttggttagttcattgcagggcacagatgctt
>gnl|bcl2dbcds|A0A8C4SET9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAD (length=432 residues).
atggcaaagatgttcagtctttcagattctgaatcagatatttctgatgatgtcattcaagatggtgactcaagtggaag
agaagtaagaaatgcaagttcagtgaaacaaagcagaacaatgccttcaatcaagatgtcggatgtggaagggcgaatta
ggggggtttcagaatcccaggcatcagaggcagagatggatgatgaattaacctctttccgaaatcggtcacattcagca
cctccagcattgtgggcagctcgtcggtatggacgtgaattgcgcagaatgagcgatgaatttggaatttctcatgggga
atttaaaagggcaaagagtgctggaactgctaagcaaatgactacctcaacaagctggtggacttttttgtggagtaaga
gacaacagtctgaatcttccaaggctaattaa
>gnl|bcl2dbcds|A0A8C4SET9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAD (length=459 residues).
atgtcttctattttaacagatgcagtgatggcaaagatgttcagtctttcagattctgaatcagatatttctgatgatgt
cattcaagatggtgactcaagtggaagagaagtaagaaatgcaagttcagtgaaacaaagcagaacaatgccttcaatca
agatgtcggatgtggaagggcgaattaggggggtttcagaatcccaggcatcagaggcagagatggatgatgaattaacc
tctttccgaaatcggtcacattcagcacctccagcattgtgggcagctcgtcggtatggacgtgaattgcgcagaatgag
cgatgaatttggaatttctcatggggaatttaaaagggcaaagagtgctggaactgctaagcaaatgactacctcaacaa
gctggtggacttttttgtggagtaagagacaacagtctgaatcttccaaggctaattaa
>gnl|bcl2dbcds|A0A8C4SHZ6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BMF (length=615 residues).
atggtagctgaagtcgaagtgactctgaatatcgacccttttgtcttgtttgacagattaccattgagatcacgtatacg
tatggatccagaggaggacattgaggatgatgtgtttcatccgccagaactggacaggtacccacacacaataagtggga
cgttccgacactgcagcacttccccacgggcaaaccctttttttatttgccagcgctttcgagaagtgaaatacgtggac
cagagcacacagacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggggttcaagaggagccttcata
tctcttttacggtacagcagcccatcgcttgcacttcccagcacattttgaggtggatcgagatggggacacggaagaag
gaatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatcggccaaaagcttcaaagaattggagatcag
ttccacagagattacacacaaatgctacagcagaaccaaaggaacccccagccattgtggtggaggatggccgtcacctt
gttggcctttcttttcgatcgagatgcaggtccgaatcgaatggacgcaagatga
>gnl|bcl2dbcds|A0A8C4SHZ6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BMF (length=534 residues).
atggatccagaggaggacattgaggatgatgtgtttcatccgccagaactggacaggtacccacacacaataagtgggac
gttccgacactgcagcacttccccacgggcaaaccctttttttatttgccagcgctttcgagaagtgaaatacgtggacc
agagcacacagacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggggttcaagaggagccttcatat
ctcttttacggtacagcagcccatcgcttgcacttcccagcacattttgaggtggatcgagatggggacacggaagaagg
aatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatcggccaaaagcttcaaagaattggagatcagt
tccacagagattacacacaaatgctacagcagaaccaaaggaacccccagccattgtggtggaggatggccgtcaccttg
ttggcctttcttttcgatcgagatgcaggtccgaatcgaatggacgcaagatga
© 1998-2022Legal notice