Dataset for CDS classical BH3-containing proteins of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4SET9_BAD-01       ---------------------------atggca-----------------
A0A8C4SET9_BAD-02       atgtcttctattttaacagatgcagtgatggca-----------------
A0A8C4SHZ6_BMF-02       ---------------------------atggtagctgaagtcgaagtgac
A0A8C4SHZ6_BMF-01       --------------------------------------------------
A0A8C4REW7_BCL2L11      ---------------------------atggca-----------------
A0A8C4REW7_BCL2L11      ---------------------------atggca-----------------
                                                                          

A0A8C4SET9_BAD-01       ---------------------------------------------aagat
A0A8C4SET9_BAD-02       ---------------------------------------------aagat
A0A8C4SHZ6_BMF-02       tctgaatatcgacccttttgtcttgtttgacagattaccattgagatcac
A0A8C4SHZ6_BMF-01       --------------------------------------------------
A0A8C4REW7_BCL2L11      -------------------------------------------cgaccac
A0A8C4REW7_BCL2L11      -------------------------------------------cgaccac
                                                                          

A0A8C4SET9_BAD-01       gttcagtctttcagattctgaatcagatatttctgatgatg---------
A0A8C4SET9_BAD-02       gttcagtctttcagattctgaatcagatatttctgatgatg---------
A0A8C4SHZ6_BMF-02       gtatacgtat--ggatccagaggaggacattgaggatgatgtgtt-----
A0A8C4SHZ6_BMF-01       --------at--ggatccagaggaggacattgaggatgatgtgtt-----
A0A8C4REW7_BCL2L11      cctcagatct--aaattctgaaagtggcgcaggggatggtggaccattgc
A0A8C4REW7_BCL2L11      cctcagatct--aaattctgaaagtggcgcaggggatggtggaccattgc
                                 *    ** * **    *        **** **         

A0A8C4SET9_BAD-01       -------------------tcattcaagatggtgactcaagtggaag---
A0A8C4SET9_BAD-02       -------------------tcattcaagatggtgactcaagtggaag---
A0A8C4SHZ6_BMF-02       -------------------tcatccgccagaactggacaggt------ac
A0A8C4SHZ6_BMF-01       -------------------tcatccgccagaactggacaggt------ac
A0A8C4REW7_BCL2L11      agcccacccaagaagcaggtcgtcctct-gagtagaccaggtccaaggac
A0A8C4REW7_BCL2L11      agcccacccaagaagcaggtcgtcctct-gagtagaccaggtccaaggac
                                           ** * *            ** **        

A0A8C4SET9_BAD-01       ------agaagtaagaaatgcaagttcagtgaa---------acaaagca
A0A8C4SET9_BAD-02       ------agaagtaagaaatgcaagttcagtgaa---------acaaagca
A0A8C4SHZ6_BMF-02       ccacacacaa---------------taagtgggacgttccg-acactgca
A0A8C4SHZ6_BMF-01       ccacacacaa---------------taagtgggacgttccg-acactgca
A0A8C4REW7_BCL2L11      ccattctgaaggtgaccaaagtggtgaagtgagccaacccgcacccaaca
A0A8C4REW7_BCL2L11      ccattctgaaggtgaccaaagtggtgaagtgagccaacccgcacccaaca
                                **                 ****           **    **

A0A8C4SET9_BAD-01       ga---------------acaatgccttcaa--------------------
A0A8C4SET9_BAD-02       ga---------------acaatgccttcaa--------------------
A0A8C4SHZ6_BMF-02       gc-----------actt-------ccccacgggcaaaccctt--------
A0A8C4SHZ6_BMF-01       gc-----------actt-------ccccacgggcaaaccctt--------
A0A8C4REW7_BCL2L11      gcctgcagggaggacttgctatgccccccagtccccatccttatgcctcc
A0A8C4REW7_BCL2L11      gcctgcagggaggacttgctatgccccccagtccccatccttatgcctcc
                        *                       *  *                      

A0A8C4SET9_BAD-01       ----------------------tcaagatgtcg-------gatgt-----
A0A8C4SET9_BAD-02       ----------------------tcaagatgtcg-------gatgt-----
A0A8C4SHZ6_BMF-02       ---tttttatttgccagcgctttcgagaagtga-------aatac-----
A0A8C4SHZ6_BMF-01       ---tttttatttgccagcgctttcgagaagtga-------aatac-----
A0A8C4REW7_BCL2L11      aggtttccattgtttagttatttctcaaggtcatccagtggatactattc
A0A8C4REW7_BCL2L11      aggtttccattgtttagttatttctcaaggtcatccagtggatactattc
                                              **   * **          **       

A0A8C4SET9_BAD-01       -----------------------------------ggaagggcgaattag
A0A8C4SET9_BAD-02       -----------------------------------ggaagggcgaattag
A0A8C4SHZ6_BMF-02       -------------------------------------gtggaccagagca
A0A8C4SHZ6_BMF-01       -------------------------------------gtggaccagagca
A0A8C4REW7_BCL2L11      ttttgaatctggttctgtttccagcttgccatcaatgactgacaaattca
A0A8C4REW7_BCL2L11      ttttgaatctggttctgtttccagcttgccatcaatgactgacaaattca
                                                                * * *     

A0A8C4SET9_BAD-01       gggggtttcagaat--------cccaggcatcagaggca----------g
A0A8C4SET9_BAD-02       gggggtttcagaat--------cccaggcatcagaggca----------g
A0A8C4SHZ6_BMF-02       cacagacgacgagtaatcacgtgccgagctacagcagcatgct--gcctt
A0A8C4SHZ6_BMF-01       cacagacgacgagtaatcacgtgccgagctacagcagcatgct--gcctt
A0A8C4REW7_BCL2L11      cacagacgccaagt-ctttctagtcaagcaataaga-catgcccagcagt
A0A8C4REW7_BCL2L11      cacagacgccaagt-ctttctagtcaagcaataaga-catgcccagcagt
                            *      * *          *  **   *    **           

A0A8C4SET9_BAD-01       agatggatgatgaatt-------aacctctttccgaa-----------at
A0A8C4SET9_BAD-02       agatggatgatgaatt-------aacctctttccgaa-----------at
A0A8C4SHZ6_BMF-02       acggggttcaagaggagccttcatatctcttttacggtacagcagcccat
A0A8C4SHZ6_BMF-01       acggggttcaagaggagccttcatatctcttttacggtacagcagcccat
A0A8C4REW7_BCL2L11      ggttagctcaagaata-----cgaacattatcaaggccatgacatgccac
A0A8C4REW7_BCL2L11      ggttagctcaagaata-----cgaacattatcaaggccatgacatgccac
                             * * * **           *  *  *                 * 

A0A8C4SET9_BAD-01       cggtcacattcagcacctccagcattgtgggcagctc-------------
A0A8C4SET9_BAD-02       cggtcacattcagcacctccagcattgtgggcagctc-------------
A0A8C4SHZ6_BMF-02       cgcttgcact---tcccagcacattttgaggtggatcgagatggggacac
A0A8C4SHZ6_BMF-01       cgcttgcact---tcccagcacattttgaggtggatcgagatggggacac
A0A8C4REW7_BCL2L11      aggcttcatctggtcctaccagagctagacgctcctc-------------
A0A8C4REW7_BCL2L11      aggcttcatctggtcctaccagagctagacgctcctc-------------
                         *    **       *   **    *    *    **             

A0A8C4SET9_BAD-01       ------------gtcggtatgga---------------------------
A0A8C4SET9_BAD-02       ------------gtcggtatgga---------------------------
A0A8C4SHZ6_BMF-02       ggaagaaggaatggcagaagaagaacaggagcctggtctgagcgcagaag
A0A8C4SHZ6_BMF-01       ggaagaaggaatggcagaagaagaacaggagcctggtctgagcgcagaag
A0A8C4REW7_BCL2L11      ---------aatgccagaagaga---------------tgcgaccagaag
A0A8C4REW7_BCL2L11      ---------aatgccagaagaga---------------tgcgaccagaag
                                    * * * *                               

A0A8C4SET9_BAD-01       -----------cgtgaattgcgcagaatgagcgatgaatttggaatttct
A0A8C4SET9_BAD-02       -----------cgtgaattgcgcagaatgagcgatgaatttggaatttct
A0A8C4SHZ6_BMF-02       cacagatcggccaaaagcttcaaagaattggagatcagttccacagagat
A0A8C4SHZ6_BMF-01       cacagatcggccaaaagcttcaaagaattggagatcagttccacagagat
A0A8C4REW7_BCL2L11      aaatggtggctcaagaactgcgacgaattggagacgatttcaacaatcta
A0A8C4REW7_BCL2L11      aaatggtggctcaagaactgcgacgaattggagacgatttcaacaatcta
                                   *   *  * *   ****  * **  * **    *     

A0A8C4SET9_BAD-01       catggggaatttaaaag------------------ggcaaagagtgctgg
A0A8C4SET9_BAD-02       catggggaatttaaaag------------------ggcaaagagtgctgg
A0A8C4SHZ6_BMF-02       tac-----acacaaatg-----------------------ctacagcaga
A0A8C4SHZ6_BMF-01       tac-----acacaaatg-----------------------ctacagcaga
A0A8C4REW7_BCL2L11      tat-----tttcaaagg------------------ggcatcggtggcagg
A0A8C4REW7_BCL2L11      tat-----tttcaaagggtagccagggcctatccaggcagcgtttggaga
                         *          *** *                            *  * 

A0A8C4SET9_BAD-01       aactgctaagcaaatgactacc--------------tcaacaagctggtg
A0A8C4SET9_BAD-02       aactgctaagcaaatgactacc--------------tcaacaagctggtg
A0A8C4SHZ6_BMF-02       accaaaggaacccccagccattgtggtggaggatggccgtcaccttgttg
A0A8C4SHZ6_BMF-01       accaaaggaacccccagccattgtggtggaggatggccgtcaccttgttg
A0A8C4REW7_BCL2L11      aacaatggagcagaagccagtcgtcttc--ggtgggttattgtgtttgtg
A0A8C4REW7_BCL2L11      a------gggcaggaaccagctgtggacagggttggttagt-tcattgca
                        *         *      *                           *    

A0A8C4SET9_BAD-01       gacttttttgtggagtaagagacaacagtctgaatcttccaaggctaa-t
A0A8C4SET9_BAD-02       gacttttttgtggagtaagagacaacagtctgaatcttccaaggctaa-t
A0A8C4SHZ6_BMF-02       gcctttcttttcgatcgagatgca--ggtccgaatcgaatggacgcaaga
A0A8C4SHZ6_BMF-01       gcctttcttttcgatcgagatgca--ggtccgaatcgaatggacgcaaga
A0A8C4REW7_BCL2L11      tggcgactttttgat------------attttaacaagatggcgttaa--
A0A8C4REW7_BCL2L11      gggca-----cagat------------gctt-------------------
                                    **                                    

A0A8C4SET9_BAD-01       taa
A0A8C4SET9_BAD-02       taa
A0A8C4SHZ6_BMF-02       tga
A0A8C4SHZ6_BMF-01       tga
A0A8C4REW7_BCL2L11      ---
A0A8C4REW7_BCL2L11      ---
                           

© 1998-2022Legal notice