Dataset for CDS BCL2L11 of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=243 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggttagagcaatagaggaggttgtcgtg
tag
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=264 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaagcttccatgaggcagtcgcaggcggtccctgcagaca
tgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctcttacccacggaggctggca
caatgcctggcattctacacctga
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=504 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaaggtaatcccggaggcgaaggggaccgctgcccccaag
gcagccctctgggcccgctggccccaccggccagccctggcccttttgctaccagatccccgtttttcatctttgtgaga
agatcttccctgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctct
tacccacggaggttagagcaatag
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=702 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccctgcggagcgcgg
cggcggcgggcgggcggcaagcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctttgtctccccc
gctgcctaagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacgccgcggggcccgggcccggacg
cgacgctcggaagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctgagtgtgacag
agaaggcggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
aagacaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttgccaagccttcaaccactat
ctcagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagct
gcggagaattggagacgaatttaatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctgaagcccacc
cccaaatgatcatcttgcgactgttacgttacatcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=870 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccctgcggagcgcgg
cggcggcgggcgggcggcaagcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctttgtctccccc
gctgcctaagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacgccgcggggcccgggcccggacg
cgacgctcggaagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctgagtgtgacag
agaaggcggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
aaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctctgggcccgctggccccaccggccagccctggc
ccttttgctaccagatccccgtttttcatctttgtgagaagatcttccctgctgtctcgctcctccagtgggtatttctc
ttttgacacagacaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttgccaagccttca
accactatctcagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccggaggtatggatcgct
caagagctgcggagaattggagacgaatttaatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctga
agcccacccccaaatgatcatcttgcgactgttacgttacatcatccgcctggtacggagactgcagtga
© 1998-2020Legal notice