Dataset for CDS BCL2L11 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A3Q2GRS5_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cggagccctcggctgccctgcggagcgcggcggcggcgggcgggcggcaa
A0A3Q2GRS5_BCL2L11      cggagccctcggctgccctgcggagcgcggcggcggcgggcgggcggcaa

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctt
A0A3Q2GRS5_BCL2L11      gcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctt

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgtctcccccgctgcctaagtggcgacaatcagggggctccgggtcggcg
A0A3Q2GRS5_BCL2L11      tgtctcccccgctgcctaagtggcgacaatcagggggctccgggtcggcg

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      aaaggcgcgggctggacgccgcggggcccgggcccggacgcgacgctcgg
A0A3Q2GRS5_BCL2L11      aaaggcgcgggctggacgccgcggggcccgggcccggacgcgacgctcgg

A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      aagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      aagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgat

A0A3Q2GRS5_BCL2L11      gtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagag
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagag
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagag
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagag
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagag

A0A3Q2GRS5_BCL2L11      gcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
A0A3Q2GRS5_BCL2L11      gcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
A0A3Q2GRS5_BCL2L11      gcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
A0A3Q2GRS5_BCL2L11      gcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
A0A3Q2GRS5_BCL2L11      gcctcctcagctcaggcctggggcccccacctctctacagatagagcagc

A0A3Q2GRS5_BCL2L11      a-------------------------------------------------
A0A3Q2GRS5_BCL2L11      a-------------------------------------------------
A0A3Q2GRS5_BCL2L11      aaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctctg
A0A3Q2GRS5_BCL2L11      aaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctctg
A0A3Q2GRS5_BCL2L11      a-------------------------------------------------

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ggcccgctggccccaccggccagccctggcccttttgctaccagatcccc
A0A3Q2GRS5_BCL2L11      ggcccgctggccccaccggccagccctggcccttttgctaccagatcccc
A0A3Q2GRS5_BCL2L11      --------------------------------------------------

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gtttttcatctttgtgagaagatcttccctgctgtctcgctcctccagtg
A0A3Q2GRS5_BCL2L11      gtttttcatctttgtgagaagatcttccctgctgtctcgctcctccagtg
A0A3Q2GRS5_BCL2L11      --------------------------------------------------

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac
A0A3Q2GRS5_BCL2L11      ggtatttctcttttgacacagacaggagcccggcacccatgagttgtgac
A0A3Q2GRS5_BCL2L11      ggtatttctcttttgacacagacaggagcccggcacccatgagttgtgac
A0A3Q2GRS5_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac

A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      aaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatct
A0A3Q2GRS5_BCL2L11      aaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatct
A0A3Q2GRS5_BCL2L11      aaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatct
A0A3Q2GRS5_BCL2L11      aaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatct

A0A3Q2GRS5_BCL2L11      ---------agcttccatgaggcagtcgcaggcggtccctgcagacatgc
A0A3Q2GRS5_BCL2L11      cagtgcaatggtt-------------------------------------
A0A3Q2GRS5_BCL2L11      cagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgc
A0A3Q2GRS5_BCL2L11      cagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgc
A0A3Q2GRS5_BCL2L11      cagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgc
                                  * *                                     

A0A3Q2GRS5_BCL2L11      gcccggaggtatggatcgctcaagagctgcggagaattggagacgaattt
A0A3Q2GRS5_BCL2L11      ----------------------agagcaatagagga--------------
A0A3Q2GRS5_BCL2L11      gcccggaggtatggatcgctcaagagctgcggagaattggagacgaattt
A0A3Q2GRS5_BCL2L11      gcccggaggtatggatcgctcaagagctgcggagaattggagacgaattt
A0A3Q2GRS5_BCL2L11      gcccggaggtatggatcgctcaagagctgcggagaattggagacgaattt
                                              *****    *** *              

A0A3Q2GRS5_BCL2L11      aatgcctcttacccacggaggctggcaca---------------------
A0A3Q2GRS5_BCL2L11      --------------------ggttgtcgt---------------------
A0A3Q2GRS5_BCL2L11      aatgcctcttacccacggaggtt---------------------------
A0A3Q2GRS5_BCL2L11      aatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctga
A0A3Q2GRS5_BCL2L11      aatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctga
                                            * *                           

A0A3Q2GRS5_BCL2L11      ------------------------atgcctggcattctacacc-------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      agcccacccccaaatgatcatcttgcgactgttacgttacatcatccgcc
A0A3Q2GRS5_BCL2L11      agcccacccccaaatgatcatcttgcgactgttacgttacatcatccgcc

A0A3Q2GRS5_BCL2L11      -----------------tga
A0A3Q2GRS5_BCL2L11      ----------------gtag
A0A3Q2GRS5_BCL2L11      --------aga--gcaatag
A0A3Q2GRS5_BCL2L11      tggtacggagactgcagtga
A0A3Q2GRS5_BCL2L11      tggtacggagactgcagtga

© 1998-2021Legal notice