Dataset for CDS classical BH3-containing proteins of organism Delphinapterus leucas

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A2Y9P485_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Delphinapterus leucas GN=PMAIP1 (length=165 residues).
atgcctggaaggagggttcgtaagagcgctcagcagagcccgacgcgggctccggcagatcctgaagttgagtgtgccat
tcagttcaggagaattggagacaaactgaatttccggcagaaacttctgaatttgatatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2Y9PEE3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Delphinapterus leucas GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctcggccgtatcctgcggcctctgcgaacccggcctgcctgccgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcacagccgccctgggggccccccgctggcctgggggt
cctcgcagccggccccgaggcccgcgccccgacggtccacagccctcactctcgcccgcggagcagcacctggaatcgct
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgatctcaacgcgctgtacgaacggcggagacaagaggagcag
cagcgacaccgcccctccccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccgcggagc
ccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A2Y9Q753_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcctcctca
gctcaggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccactggccccaccggccagtcccggccctttcgctaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataatcaccaagcagccgaaggtcacccgcaaatggttatcttacggctcttacgcca
catcgtccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A2Y9Q753_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2L11 (length=699 residues).
atgttcccggcggctgcggtcggggtagcgcgtaccggagacgcggcgtgcggagccctcagctgcccggcggagcgcgg
cagcggacgggcggcgagttgcaggctctccgctgccccgggcgctccgaccgcgagtcccgggctttgtctcccgggcc
gccttcgtgttgacggtcagggggctccgggtcggcgaagggcgcgggctgggcgccgccgggccccggcccggacgcga
cgctcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgacagaga
aggtggacaattgcagcctgccgaaaggcctcctcagctcaggcctggggcccccatctctctacagacagagcggcaag
acaggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
agtgcgatggcttccatgaggcagtctcaggctgtacctgcagatatgcgtccggagatatggattgcgcaagagttgcg
gcgtattggagacgaatttaatgcatattacccaaggagggtctttctgaataatcaccaagcagccgaaggtcacccgc
aaatggttatcttacggctcttacgccacatcgtccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A2Y9Q8G3_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Delphinapterus leucas GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggcccgccggcggtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcgaaacttgtag
© 1998-2020Legal notice