Dataset for CDS classical BH3-containing proteins of organism Delphinapterus leucas

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      atgttcccggcggctgcggtcggggtagcgcgtaccggagacgcggcgtg
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      cggagccctcagctgcccggcggagcgcggcagcggacgggcggcgagtt
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gcaggctctccgctgccccgggcgctccgaccgcgagtcccgggctttgt
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ctcccgggccgccttcgtgttgacggtcagggggctccgggtcggcgaag
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ggcgcgggctgggcgccgccgggccccggcccggacgcgacgctcggaag
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------atggcccgagcacgccaggagggc
A0A2Y9Q8G3_HRK-01       --------------------------atg---------------------
A0A2Y9P485_PMAIP1-      --------------------------atgcc---------------tgga
A0A2Y9Q753_BCL2L11      --------------------------atggcaaagcaaccttccgatgta
A0A2Y9Q753_BCL2L11      ggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttccgatgta
                                                  ***                     

A0A2Y9PEE3_BBC3-01      agctcccccgagcccgtagagggcctggcccgcgacggcccgcgtccctt
A0A2Y9Q8G3_HRK-01       ------------------------------------tgcccgtgccccct
A0A2Y9P485_PMAIP1-      ag----------------gagggtt-----------cgtaagagcg----
A0A2Y9Q753_BCL2L11      agttctgagtgtgacagagaaggtg-----------gacaattgcagcct
A0A2Y9Q753_BCL2L11      agttctgagtgtgacagagaaggtg-----------gacaattgcagcct
                                                                   *      

A0A2Y9PEE3_BBC3-01      ccccctcagccgcctggtgccctcggccgtatcctgcggcctctgcgaac
A0A2Y9Q8G3_HRK-01       gcaccgcggccg--------------------------------------
A0A2Y9P485_PMAIP1-      -------------ct-----------------------------------
A0A2Y9Q753_BCL2L11      gccgaaaggcctcct-----------------------------------
A0A2Y9Q753_BCL2L11      gccgaaaggcctcct-----------------------------------
                                                                          

A0A2Y9PEE3_BBC3-01      ccggcct--gcctgccgcccccgccgcccccgccctgctgccc--gccgc
A0A2Y9Q8G3_HRK-01       -cggccc--gccggcggtgtgcg----------cctgcagcgcgggccgc
A0A2Y9P485_PMAIP1-      -cagc---------------------------------------------
A0A2Y9Q753_BCL2L11      -cagctcaggcctggggccccca------tctctctacagacagagcggc
A0A2Y9Q753_BCL2L11      -cagctcaggcctggggccccca------tctctctacagacagagcggc
                         * **                                             

A0A2Y9PEE3_BBC3-01      ctacctctgcgccc--ccaccgccccgcccgccgtcacagccgccctggg
A0A2Y9Q8G3_HRK-01       ctgggtctgcgctcgtccgccgcgcagc------tcacggccgccc----
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      aaggtaatcccgaaggagaaggggaccgctgcccccaaggcagcccacag
A0A2Y9Q753_BCL2L11      a-------------------------------------------------
                                                                          

A0A2Y9PEE3_BBC3-01      ggccccccgctggcctgg--------------------------------
A0A2Y9Q8G3_HRK-01       -----------ggctcaa--------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ggcccactggccccaccggccagtcccggccctttcgctaccagatcccc
A0A2Y9Q753_BCL2L11      --------------------------------------------------
                                                                          

A0A2Y9PEE3_BBC3-01      --------------------------------------------------
A0A2Y9Q8G3_HRK-01       --------------------------------------------------
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gcttttcatcttcgtgagaagatcttccctgctgtctcgatcctccagtg
A0A2Y9Q753_BCL2L11      --------------------------------------------------
                                                                          

A0A2Y9PEE3_BBC3-01      ------------------------gggtcctcgcagccggccccgaggcc
A0A2Y9Q8G3_HRK-01       ------------------------ggcgctcggcgacgagctgc---acc
A0A2Y9P485_PMAIP1-      ------------------------agagcccgac----------------
A0A2Y9Q753_BCL2L11      ggtatttctcttttgacacagacaggagcccggcacccatgagttgtgac
A0A2Y9Q753_BCL2L11      -------------------agacaggagcccggcacccatgagttgtgac
                                                 *  *    *                

A0A2Y9PEE3_BBC3-01      cgcgcccc----gacggtccacagccctcactctcgcccgcggagcagca
A0A2Y9Q8G3_HRK-01       agcgcaccatgtggcggcgc--------------cgcgcgcggag-----
A0A2Y9P485_PMAIP1-      --------------------------------------------------
A0A2Y9Q753_BCL2L11      aaatcaaca---caaaccccaagtcctccttgccaggccttcaaccatta
A0A2Y9Q753_BCL2L11      aaatcaaca---caaaccccaagtcctccttgccaggccttcaaccatta
                                                                          

A0A2Y9PEE3_BBC3-01      cctggaatcgctagtgccca----gcgccccgggggccctggcgggcggc
A0A2Y9Q8G3_HRK-01       ccggagggcgccggcgccca----gcgcgct------------------c
A0A2Y9P485_PMAIP1-      ------------------------gcgggct----------ccggcagat
A0A2Y9Q753_BCL2L11      tctcagtgcgatggcttccatgaggcagtct----------caggctgta
A0A2Y9Q753_BCL2L11      tctcagtgcgatggcttccatgaggcagtct----------caggctgta
                                                **   *                    

A0A2Y9PEE3_BBC3-01      cccacccaagcggccccgggagtccggggggaggaggagcagtgggcccg
A0A2Y9Q8G3_HRK-01       cccacctac-tggccctgg-------------------------------
A0A2Y9P485_PMAIP1-      cctgaag-----------------ttgagtg-------------------
A0A2Y9Q753_BCL2L11      cctgcagatatgcgtccggagatatggattg-------------------
A0A2Y9Q753_BCL2L11      cctgcagatatgcgtccggagatatggattg-------------------
                        **                                                

A0A2Y9PEE3_BBC3-01      agagatcggggcccagctgcggcggatggcggacgatctcaacgcgctgt
A0A2Y9Q8G3_HRK-01       ------ctgtgcgcggccgc-gcaggtggcg------------gcgct--
A0A2Y9P485_PMAIP1-      ------tgccattcagttcaggagaattggagacaaactga------att
A0A2Y9Q753_BCL2L11      ------cgcaag--agttgcggcgtattggagacgaatttaatgcatatt
A0A2Y9Q753_BCL2L11      ------cgcaag--agttgcggcgtattggagacgaatttaatgcatatt
                                       *     *    * *                     

A0A2Y9PEE3_BBC3-01      acgaacggcggagacaagaggagcagcagcgacaccgcccctccccctgg
A0A2Y9Q8G3_HRK-01       ------ggcgg----------------------------------cctgg
A0A2Y9P485_PMAIP1-      tcc---ggcag---------aaacttctgaat------------------
A0A2Y9Q753_BCL2L11      acccaaggagg---------gtctttctgaataatcaccaagcagccgaa
A0A2Y9Q753_BCL2L11      acccaaggagg---------gtctttctgaataatcaccaagcagccgaa
                              **  *                                       

A0A2Y9PEE3_BBC3-01      agggtcctgtacaatctcatcatgggactcctgcccttacccaggggccg
A0A2Y9Q8G3_HRK-01       ------ctg------ctcggcaggcgaaacttg-----------------
A0A2Y9P485_PMAIP1-      -------------ttgatatccaa--actcttccgct---------c---
A0A2Y9Q753_BCL2L11      ggtcacccgcaaatggttatcttacggctcttacgcc---------acat
A0A2Y9Q753_BCL2L11      ggtcacccgcaaatggttatcttacggctcttacgcc---------acat
                                            *        * *                  

A0A2Y9PEE3_BBC3-01      cggagcccccgagatggagcccaattag
A0A2Y9Q8G3_HRK-01       -------------------------tag
A0A2Y9P485_PMAIP1-      ----------------aggaacc--tga
A0A2Y9Q753_BCL2L11      cgtccgtctggtgtggaggatgcagtga
A0A2Y9Q753_BCL2L11      cgtccgtctggtgtggaggatgcagtga
                                                 *  

© 1998-2020Legal notice