Dataset for CDS classical BH3-containing proteins of organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A7MCM4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctccgatgattcagagacagaaacaatggaagacagtgaagcctcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|B2KKY9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgtgctcccaacgaacacgccatcgtcctgtgg
atgaacgtcattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|Q0GKC7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio GN=BMF (length=429 residues).
atggatgaggacgaggatgatgtgttcaggaagggtctccagcactggcctcctccccacctgcagataaagcagactga
gttggcaggacgtcccgctgggtcacgcaacggtatgctgctctgccggcatctccagcagcacggacactttctctacg
gtaacgcagaattgctggttctagctgcgtccagccgcgctcagcctccagacgtggtgttacggcagaacgtctcaccg
atggagcgaccagagccccgacctgcacagagcgtggaaaccctcatcggacagaagctgcagctgattggagatcagtt
ctatcaggagcacatcatgcatcatcaaaggccgcaggatccgctgtggaggcgtgtggcgacggccgtcctcacgctgc
tgttcggcgccagagagaaccgcaggtga
© 1998-2022Legal notice