Dataset for CDS classical BH3-containing proteins of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A7MCM4_BAD-01          atggcacatat---gtttaatatctccgatgattcagagacagaaacaat
B2KKY9_BCL2L11-01      at------------gtctgacacgtccagag----ag-----caaacgct
Q0GKC7_BMF-01          atggatgaggacgaggatgatgtgttcagga----agggtctccagcact
                       **            *  * *    * *        **       * *  *

A7MCM4_BAD-01          ggaagacagtgaagcctcaagcctggataaacacaagagtgggt-----c
B2KKY9_BCL2L11-01      ggccaat------ggcccggcctcgcagg-gaagcggagagagcaccggt
Q0GKC7_BMF-01          ggcctcc------tcccca--cctgcagataaagcagactgagt-----t
                       **             * *   *  * *     *   **  * *       

A7MCM4_BAD-01          ggcacagaaaaagcagcacctcactg--------------ttcctgatag
B2KKY9_BCL2L11-01      ggc----ggagtggtgttgcccgccggg---cactttgatttcc--ctca
Q0GKC7_BMF-01          ggc----aggacg-----tcccgctgggtcacgcaacggtatgctgctct
                       ***         *      * * * *               * *   *  

A7MCM4_BAD-01          gctga---aaggagagcaactgggcagacagaggaacctctcgatgaatg
B2KKY9_BCL2L11-01      gccgggcgaaggggacccgttaaggggagggatatccatgtcgaataacc
Q0GKC7_BMF-01          gccgg-------------------------------catctccagcagc-
                       ** *                                * * ** *  *   

A7MCM4_BAD-01          aggaggacttgctgg-aaactggagttgcagaagatcctcatatgct---
B2KKY9_BCL2L11-01      agtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctat
Q0GKC7_BMF-01          --------------acggac---actttctctacg-------gtaac---
                                         **   * ** *   *          *      

A7MCM4_BAD-01          -------tggggatcctttcaggccgagatccc--------gctcagctc
B2KKY9_BCL2L11-01      ttttccgtcgacagcgattctgtgccaggttcccctctaatgcccaatat
Q0GKC7_BMF-01          ----------gcagaattgctggttctagctgc--------gtccagccg
                                   *    * * *          *        *  **    

A7MCM4_BAD-01          ctcctgctttgtgggcagctaaga------aatacggccaacagc-----
B2KKY9_BCL2L11-01      ttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacata
Q0GKC7_BMF-01          cgctcagcctccagacg-------tggt--gttacgg----cagaacgt-
                         *          * *                ** **    ***      

A7MCM4_BAD-01          ----------tgagaagaatgagtgatgagtttgataaagggcagatgaa
B2KKY9_BCL2L11-01      gccaccagcacttgcagatggcagcaccagtcgcagccctg-ccgccgga
Q0GKC7_BMF-01          ----------ctcaccgatggagcgaccag----agccccgacctgcaca
                                       **  *    *  **    *     * *      *

A7MCM4_BAD-01          gagagtaaaaa--------gtgcaggaactgcgcgtca-----gatgag-
B2KKY9_BCL2L11-01      gatggtgg---------tcgctcgtgaactgcgacgcataggcgatgagt
Q0GKC7_BMF-01          gagcgtggaaaccctcatcggacagaagctgcagctgattggagatcagt
                       **  **             *  *   * ****     *     *** ** 

A7MCM4_BAD-01          tcaatcgcc------------------cagctggttggcatttctttgga
B2KKY9_BCL2L11-01      tcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgtgct
Q0GKC7_BMF-01          tctat----------------------caggagcacatca--tgcat---
                       ** **                      ***  *     **  *   *   

A7MCM4_BAD-01          gtca-caaaga-------gtctgatgcggagtcgcg--------------
B2KKY9_BCL2L11-01      cccaacgaacacgccatcgtc--ctgtggatgaacgtcattatcggacg-
Q0GKC7_BMF-01          --catcaaaggccgcaggatccgctgtggaggcgtgtggcga-cggccgt
                         ** * **          **   ** ***     *              

A7MCM4_BAD-01          ccccgca---------------------------gagtga
B2KKY9_BCL2L11-01      cctagtacacttttt-----cctgcgaaga----agatga
Q0GKC7_BMF-01          cctcacgctgctgttcggcgccagagagaaccgcaggtga
                       **                                   ***

© 1998-2022Legal notice