Dataset for CDS classical BH3-containing proteins of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q0GKC7_BMF-01          atggatgaggacgaggatga-tgtgttcaggaagggtctccagcactggc
B2KKY9_BCL2L11-01      atgtctgacacgtccagagagc------------------aaacgctggc
B8JK68_BCL2L11-01      atgtctgacacgtccagagagc------------------aaacgctggc
E7FBJ6_BAD-01          atggagaacacctcgcatgaccatcaagat---gattccagcaccttgga
A7MCM4_BAD-01          atggcacatatgtttaatatctccgatgattcagagacagaaacaatgga
Q4V925_BAD-03          atggcacatatgtttaatatctctgatgattcagagacagaaacaatgga
Q4V925_BAD-02          atggcacatatgtttaatatctctgatgattcagagacagaaacaatgga
Q4V925_BAD-01          atggcacatatgtttaatatctctgatgattcagagacagaaacaatgga
Q4V925_BAD-04          atggcacatatgtttaatatctctgatgattcagagacagaaacaatgga
Q0GKC8_PMAIP1-01       atggc---------------------------------------------

Q0GKC7_BMF-01          ctcc--------tccccacctgc-----------agataaagcagactga
B2KKY9_BCL2L11-01      caatggcccggcctcgca----------------gggaagcggagagagc
B8JK68_BCL2L11-01      caatggcccggcctcgca----------------gggaagcggagagagc
E7FBJ6_BAD-01          tgaaaaagagagatcacatctgaaagggacaatcaagaaccatggacaac
A7MCM4_BAD-01          agacagtgaagcctcaagcctgg-----------ataaacacaagagtgg
Q4V925_BAD-03          agacagtgaagactcaagcctgg-----------ataaacacaagagtgg
Q4V925_BAD-02          agacagtgaagactcaagcctgg-----------ataaacacaagagtgg
Q4V925_BAD-01          agacagtgaagactcaagcctgg-----------ataaacacaagagtgg
Q4V925_BAD-04          agacagtgaagactcaagcctgg-----------ataaacacaagagtgg
Q0GKC8_PMAIP1-01       --------------------------------------------------

Q0GKC7_BMF-01          gttggca--ggacgtcccgctgggtcac-----gcaa-----------cg
B2KKY9_BCL2L11-01      accggtggcgga---------------------gtggtgttgcccgccgg
B8JK68_BCL2L11-01      accggtggcgga---------------------gtggtgttgcccgccgg
E7FBJ6_BAD-01          atcaggatcgaacatcggccaacatttctcctcaagg-----------gc
A7MCM4_BAD-01          gtcggcacagaa---------------------aaag-----------ca
Q4V925_BAD-03          gtcggcacagaa---------------------aaag-----------ca
Q4V925_BAD-02          gtcggcacagaa---------------------aaag-----------ca
Q4V925_BAD-01          gtcggcacagaa---------------------aaag-----------ca
Q4V925_BAD-04          gtcggcacagaa---------------------aaag-----------ca
Q0GKC8_PMAIP1-01       ---------gaa---------------------gaaa-----------ga
                                * *                                      

Q0GKC7_BMF-01          gtatgctgctctgccggcatctccagcagcacggacactttctctacggt
B2KKY9_BCL2L11-01      gcactttgatttccctcagccgggcgaagggg------acccgttaaggg
B8JK68_BCL2L11-01      gcactttgatttccctcagccgggcgaagggg------acccgttaaggg
E7FBJ6_BAD-01          gtgtgcggctctattcggaatctcaagtgtatacagtcagccgctggcag
A7MCM4_BAD-01          gcacctcactgttcctgataggctgaaaggag------agcaactgggca
Q4V925_BAD-03          gcacctcactgttcctgataggctgaaaggag------agcaactgggca
Q4V925_BAD-02          gcacctcactgttcctgataggctgaaaggag------agcaactgggca
Q4V925_BAD-01          gcacctcactgttcctgataggctgaaaggag------agcaactgggca
Q4V925_BAD-04          gcacctcactgttcctgataggctgaaaggag------agcaactgggca
Q0GKC8_PMAIP1-01       gcaaaccgctgt---------------agtag------ag----------
                       *        * *                *                     

Q0GKC7_BMF-01          aacgcagaattgctggttctagctgcgtccagccgcgctcagcctccaga
B2KKY9_BCL2L11-01      gagggatatccatgtcgaataaccagtcgaggtcaccgatgaac------
B8JK68_BCL2L11-01      gagggatatccatgtcgaataaccagtcgaggtcaccgatgaac------
E7FBJ6_BAD-01          gacacagagaccc---------------------------agga------
A7MCM4_BAD-01          gacagaggaacctctcgatgaatgaggaggacttgctgg-aaac------
Q4V925_BAD-03          gacagaggaacctctcgatgaatgaggaggacttgctgg-aaac------
Q4V925_BAD-02          gacagaggaacctctcgatgaatgaggaggacttgctgg-aaac------
Q4V925_BAD-01          gacagaggaacctctcgatgaatgaggaggacttgctgg-aaac------
Q4V925_BAD-04          gacagaggaacctctcgatgaatgaggaggacttgctgg-aaac------
Q0GKC8_PMAIP1-01       --------------------------------------------------

Q0GKC7_BMF-01          cgtggtgttacggcagaacgtctcaccgatggagc---------------
B2KKY9_BCL2L11-01      --cggactttctccaggtcctctagtggctatttttccgtcgacagcgat
B8JK68_BCL2L11-01      --cggactttctccaggtcctctagtggctatttttccgtcgacagcgat
E7FBJ6_BAD-01          --tggagcatcggtggaggagaacggagatggacttcc-----------a
A7MCM4_BAD-01          --tggagttgcagaagatcctcatatgcttggggatcc-----------t
Q4V925_BAD-03          --tggagttgcagaagatcctcatatgcttggggatcc-----------t
Q4V925_BAD-02          --tggagttgcagaagatcctcatatgcttggggatcc-----------t
Q4V925_BAD-01          --tggagttgcagaagatcctcatatgcttggggatcc-----------t
Q4V925_BAD-04          --tggagttgcagaagatcctcatatgcttggggatcc-----------t
Q0GKC8_PMAIP1-01       --------------------------------------------------

Q0GKC7_BMF-01          ----gaccagagccccgacc---------------------------tgc
B2KKY9_BCL2L11-01      tctgtgccaggttcccctctaatgcccaatatttccgaagcgcaagacgg
B8JK68_BCL2L11-01      tctgtgccaggttcccctctaatgcccaatatttccgaagcgcaagacgg
E7FBJ6_BAD-01          ttcaggggtcgttctcaatcagcacctgctgcac-------------tgt
A7MCM4_BAD-01          ttcaggccgagatcccgctcagctcctcctgctt-------------tgt
Q4V925_BAD-03          ttcaggccgagatcccgctcagctcctcctgctt-------------tgt
Q4V925_BAD-02          ttcaggccgagatcccgctcagctcctcctgctt-------------tgt
Q4V925_BAD-01          ttcaggccgagatcccgctcagctcctcctgctt-------------tgt
Q4V925_BAD-04          ttcaggccgagatcccgctcagctcctcctgctt-------------tgt
Q0GKC8_PMAIP1-01       --------------------------------------------------

Q0GKC7_BMF-01          acagagcgtggaaaccctcatcggacagaag-------------------
B2KKY9_BCL2L11-01      acaaaatgatgaggta-----tggttatcagaacatagccaccagcactt
B8JK68_BCL2L11-01      acaaaatgatgaggta-----tggttatcagaacatagccaccagcactt
E7FBJ6_BAD-01          ggaaagcaaaaaagta-----tggccgtcag-------------------
A7MCM4_BAD-01          gggcagctaagaaata-----cggccaacag-------------------
Q4V925_BAD-03          gggcagctaagaaata-----cggccaacag-------------------
Q4V925_BAD-02          gggcagctaagaaata-----cggccaacag-------------------
Q4V925_BAD-01          gggcagctaagaaata-----cggccaacag-------------------
Q4V925_BAD-04          gggcagctaagaaata-----cggccaacag-------------------
Q0GKC8_PMAIP1-01       --------------tg-----cgcgcagcag-------------------
                                             *      **                   

Q0GKC7_BMF-01          --------------------------------------------------
B2KKY9_BCL2L11-01      gcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctc
B8JK68_BCL2L11-01      gcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctc
E7FBJ6_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
Q0GKC8_PMAIP1-01       --------------------------------------------------

Q0GKC7_BMF-01          -----ctgcagctgattggagatcagttctatcaggagcacatcatgcat
B2KKY9_BCL2L11-01      gtgaactgcgacgcataggcgatgagttcaatcgcctctactgtgaggcc
B8JK68_BCL2L11-01      gtgaactgcgacgcataggcgatgagttcaatcgcctctactgtgaggcc
E7FBJ6_BAD-01          -----ttgaggagaatgagcgatgaattcgacacatggctcgataaag-g
A7MCM4_BAD-01          -----ctgagaagaatgagtgatgagtttgataaagggc-agatgaag-a
Q4V925_BAD-03          -----ctgagaagaatgagtgatgagtttgataaagg----gatgaag-a
Q4V925_BAD-02          -----ctgagaagaatgagtgatgagtttgataaagg----gatgaag-a
Q4V925_BAD-01          -----ctgagaagaatgagtgatgagtttgataaagggc-agatgaag-a
Q4V925_BAD-04          -----ctgagaagaatgagtgatgagtttgataaagggc-agatgaag-a
Q0GKC8_PMAIP1-01       -----ttgcgaaacattggagatctgtt----------------------
                             **      **  * ***   **                      

Q0GKC7_BMF-01          catcaaaggccgcaggatccgctgt--------ggaggcgtgtggc----
B2KKY9_BCL2L11-01      ggagcaggagtgaaccagctgcgtgctcccaacgaacacgccatcgtcct
B8JK68_BCL2L11-01      ggagcaggagtgaaccagctgcatgctcccaacgaacacgccatcgtcct
E7FBJ6_BAD-01          ggtgagtaagacaccgaacagccag--------aaaca-gacctaccga-
A7MCM4_BAD-01          gagtaaaaagtgcaggaactgcgcg--------tcagatgagtcaatcgc
Q4V925_BAD-03          gagtaaaaagtgcaggaactgcgcg--------tcagatgagtcaatcgc
Q4V925_BAD-02          gagtaaaaagtgcaggaactgcgcg--------tcagatgagtcaatcgc
Q4V925_BAD-01          gagtaaaaagtgcaggaactgcgcg--------tcagatgagtcaatcgc
Q4V925_BAD-04          gagtaaaaagtgcaggaactgcgcg--------tcagatgagtcaatcgc
Q0GKC8_PMAIP1-01       ---------------gaactg---g--------aaatataagttactgg-
                                       * * *              *              

Q0GKC7_BMF-01          ---gacggccgtcctcacgctgctgttcggcgccaga----------gag
B2KKY9_BCL2L11-01      gtggatgaacgtcattatc--ggacgcctagtacactttttcctgcgaag
B8JK68_BCL2L11-01      gtggatgaacgacattatc--ggacgcctagtacactttttcctgcgaag
E7FBJ6_BAD-01          --ggatggttttcgttcctctgga-----gtcccaaa------gaagaag
A7MCM4_BAD-01          ccagctggttggcatttctttgga-----gtcacaaagagtctgatgcgg
Q4V925_BAD-03          ccagctggttggcatttctttgga-----gtcacaaagagtctgatgcgg
Q4V925_BAD-02          ccagctggttggcatttctttgga-----gtcacaaagagtctgatgcgg
Q4V925_BAD-01          ccagctggttggcatttctttgga-----gtcacaaagagtctgatgcgg
Q4V925_BAD-04          ccagctggttggcatttctttgga-----gtcacaaagagtctgatgcgg
Q0GKC8_PMAIP1-01       --agctcatagtaacactccagaa-----aatacaaa-----tggagggg
                          *                 *           **              *

Q0GKC7_BMF-01          aaccgcag--------gtga
B2KKY9_BCL2L11-01      aag-------------atga
B8JK68_BCL2L11-01      aag-------------atga
E7FBJ6_BAD-01          agg------gcagagaatga
A7MCM4_BAD-01          agtcgcgccccgcagagtga
Q4V925_BAD-03          agtcgcgccccgcagagtga
Q4V925_BAD-02          agtcgcgccccgcagagtga
Q4V925_BAD-01          agtcgcgccccgcagagtga
Q4V925_BAD-04          agtcgcgccccgcagagtga
Q0GKC8_PMAIP1-01       aagcg-----------atga
                       *                ***

© 1998-2020Legal notice