Dataset for CDS classical BH3-containing proteins of organism Cyanoderma ruficeps

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3NS85_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL2L11 (length=561 residues).
atggctaagcagccccccgaggtgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggaggggccgggccc
gggcgcgcagctgcgccccggcgctcccgccgccttgcccggggccggcccggtgtccgcggccgccgcggcgcggggcc
cgcccgccagccccggccccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctgctgccgcgctcc
tccagcgggtacttctcgttcgacgccgagcgcagccccgcgcccctgggctgcgacaaggccacgcagacccctagccc
gccctgccaggctctcagccactgcctcagcgccatggcttcccggtggcaatcccattctccagccgaagaggtgcagc
cagaaatctggattgcgcaggagctgcggcgcatcggggacgagttcaatgcctcctattgtccacgcaggggtttcttg
gatcaccaggtgggaaacccccaggtcgtcatcctgcgcctgttgcgttacatcatccgcctcatctggaggttccagtg
a
>gnl|bcl2dbcds|A0A8C3QVS1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cyanoderma ruficeps GN=BMF (length=582 residues).
atggatcgtccaagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
gatttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatcctcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgcagaggtgcagattgcacggaagttgcagtgcattgcggaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagaggtga
© 1998-2022Legal notice