Dataset for CDS classical BH3-containing proteins of organism Cyanoderma ruficeps

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3NS85_BCL2L11      atgg-----ctaagcagccccccgaggtgaaggcgcgacgcgacggcgag
A0A8C3QVS1_BMF-01       atggatcgtccaagctacc---------------------------tgga
                        ****     * ****  **                            *  

A0A8C3NS85_BCL2L11      ggcgggcggctgccggcggcggaggggccgggcccgggcgcgcagctgcg
A0A8C3QVS1_BMF-01       agaggactattctagcc--tggatgggctggacgatgacgt---gtttca
                         * ** *   *   * *   *** **** ** *   * **    * * * 

A0A8C3NS85_BCL2L11      ccccggcgctcccgccgccttgcccggggccggcccggtgtccgcggccg
A0A8C3QVS1_BMF-01       ctctgatgactttg--gacttgc---aggtcagcctggt----gagatga
                        * * *  *     *  * *****    ** * *** ***    * *    

A0A8C3NS85_BCL2L11      ccgcggcgcggggcccgcccgc-cagccccggccccttcgccacccgctc
A0A8C3QVS1_BMF-01       ctgcaac---tggctttttcacacagaaccagtcctacagctgccttctg
                        * **  *    ***     * * ***  ** * **    **  **  ** 

A0A8C3NS85_BCL2L11      g--------ccgctcttcatcttcgtgcggaggtcgccgctgctgccgcg
A0A8C3QVS1_BMF-01       gggagatttcaactattccccctcacac-------------actgctgtg
                        *        *  ** ***  * **   *              **** * *

A0A8C3NS85_BCL2L11      ctcctccagcgggtacttctcgttcgacgccgagcgcagccccgcgcccc
A0A8C3QVS1_BMF-01       gtcc--------------------cggtatcaggca-----------tcc
                         ***                    **    *  **             **

A0A8C3NS85_BCL2L11      tgggctgc--gacaaggccacgcagacccctagcccgccct------gcc
A0A8C3QVS1_BMF-01       tgagcagcaggacaaggcaactcaaacactcagcccatcctcttccagtc
                        ** ** **  ******** ** ** ** *  *****  ***      * *

A0A8C3NS85_BCL2L11      aggctctc--------------agccactgcctcagcgccatgg------
A0A8C3QVS1_BMF-01       aggatgttatgttgccttgtggagtcactg---aagagccacggagactc
                        *** * *               ** *****    ** **** **      

A0A8C3NS85_BCL2L11      ---------------------------------cttcccggtggc-----
A0A8C3QVS1_BMF-01       ttctatgggagtgctggttaccgtttacatgtccctccagctggctttgt
                                                         * *** * ****     

A0A8C3NS85_BCL2L11      ----aatcccattctccag-------ccgaagaggtgcagc---------
A0A8C3QVS1_BMF-01       gttggatcctcacctccaagaggaacctcaggaaggtcagcgggaagcac
                             ****    *****        *  * ** *  ****         

A0A8C3NS85_BCL2L11      ---cagaaatctggattgcgcaggagctgcggcgcatcggggacgagttc
A0A8C3QVS1_BMF-01       gtgcagaggtgcagattgcacggaagttgcagtgcattgcggaccagtt-
                           ****  *   ****** * * ** *** * **** * **** **** 

A0A8C3NS85_BCL2L11      aatgcctcctattgtccacgcaggggtttcttggatcaccaggtgggaaa
A0A8C3QVS1_BMF-01       ----ccaccggctccacatacagaggc-------atcagcagaacagaaa
                            ** **   *   **  *** **        **** ***    ****

A0A8C3NS85_BCL2L11      cccccaggtcgtcatcctgcgcctgttgcgttacatcatccgcctcatct
A0A8C3QVS1_BMF-01       ---tcaag---------tgtggtggcagctttttctcttcctacacaact
                            ** *         ** *   *  ** **   ** ***  * ** **

A0A8C3NS85_BCL2L11      -------------ggaggtt--------cca------------gtga
A0A8C3QVS1_BMF-01       tggccttaaacacggaggtgaacaggaaccacactgggcagaggtga
                                     ******         ***            ****

© 1998-2022Legal notice