Dataset for CDS classical BH3-containing proteins of organism Crocodylus porosus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A7M4F197_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Crocodylus porosus GN=BCL2L11 (length=912 residues).
cgtagtgggcgcagcccgcgacggccgggccccgcgcagacttgctgcgctcagcacattcgggagaacaatgggctggg
acggggccgcggccgggcggctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcacagcgcggaccc
gccgctctctcgccctcccagtcccaacacagcaagtttcgggcagagccgggagggctcggagcggagctgcttggctc
gcaagtttcacttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgctccggtcgggaccgctggggg
tttttggtctgtggaaaaaggcagtgcgttgttgtcgtatttctttgtttgtttgtttgtctgtctgtttgtgcggagca
gttgcgggagatgctttgcatccagtcacttccctgatttaatcctgtcggacggagcttgtttctcagaacttggggat
ggcgctgtgtggctgcaaagccccgatgttgtgtcgctgtggagccgggagagcttactcgcgatgctttctctttctct
gcagggaaaaaaagaccaaatggcaaaacaaccctctgatttgaattccaagtgcggcagtgaagacagacagttgcagc
cccgtgaaaggccaagtcagcctcagcccgttaggcctggggcccctacctctatacaaacacagtatcaagcttccagg
tggcaatatcgatcaatacctgaagatatgcagccagaaatatggattgcacaggaattacggcggattggagacgaatt
taatgcttcctattgcccaagacggggcttctgggataaccaaggagtaaatcaccaaattattttgcgcctcttgcatt
atatcatccgcctcatttggagaagacagtga
>gnl|bcl2dbcds|A0A7M4F197_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Crocodylus porosus GN=BCL2L11 (length=726 residues).
atgggctgggacggggccgcggccgggcggctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcaca
gcgcggacccgccgctctctcgccctcccagtcccaacacagcaagtttcgggcagagccgggagggctcggagcggagc
tgcttggctcgcaagtttcacttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgctccggtcggga
ccgctgggggtttttggtctgtggaaaaaggcaggaaaaaaagaccaaatggcaaaacaaccctctgatttgaattccaa
gtgcggcagtgaagacagacagttgcagccccgtgaaaggccaagtcagcctcagcccgttaggcctggggcccctacct
ctatacaaacacagtatcaagacaggagtcctgcgcctatgagttgcgacaagtccacacagactccaagtcccccatgt
caagcctttaatcattatttaagtgcaatgggtaagcaagatcatgcttccaggtggcaatatcgatcaatacctgaaga
tatgcagccagaaatatggattgcacaggaattacggcggattggagacgaatttaatgcttcctattgcccaagacggg
gcttctgggataaccaaggagtaaatcaccaaattattttgcgcctcttgcattatatcatccgcctcatttggagaaga
cagtga
>gnl|bcl2dbcds|A0A7M4FB17_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Crocodylus porosus GN=PMAIP1 (length=168 residues).
caaagcggccgagacagcgacacgagcgccagccccgcgccagccatgctgcccgagcgggaagcagtgagagagtgcgc
cttgcagctgcgccggatcggagaccagtgccacctgcaccagaagattttgggtctcattgcaaaacttttccgccctg
gaacgtga
>gnl|bcl2dbcds|A0A7M4FPU2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Crocodylus porosus GN=BMF (length=582 residues).
atggatccctccagctacctggaagaagactattccagcctggatgggctggatgatgatgtgtttcactctgatgactt
tggactcgcaggtcagcctggtgagatgacctctactggcattttcacacagaaccagtcctacagctgccttttgggga
gatttcaacttttcccacttactcactgctgtggtcctggcagcaggcatactgagcagcaggataaggcaactcaaaca
ctcaacccatcctcttccagtcaggatgtaatgttgccttgtggagtcactgaagagccccagagactcttctatgggaa
cgttgggtaccgtttacgtgttcccccagttggctttgctctgagtccacacctccaagaggaacatcaggaaggtcacc
aagaagtacgtgctgaggtccaaattgcacggaaattacagtgtattgcagaccagttccaccggctccacgtacaaagg
catcagcagaacagaaatcaagtgtggtggcagatacttctcttcctacataatttggccttaaatgtggaggcaaacag
gaatcaagcaggtcagaggtga
© 1998-2021Legal notice