Dataset for CDS classical BH3-containing proteins of organism Crocodylus porosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A7M4FPU2_BMF-01       --------------------------atggatccctccagctacctggaa
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      cgtagtgggcgcagcccgcgacggccgggccccgcgcagacttgctgcgc
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4FPU2_BMF-01       gaagactattccagcc-tggatgggctg-gatgatgatgtg---------
A0A7M4FB17_PMAIP1-      -----------------caaagcggccgagacagcgacacg---------
A0A7M4F197_BCL2L11      tcagcacattcgggagaacaatgggctgggacggggccgcggccgggcgg
A0A7M4F197_BCL2L11      --------------------atgggctgggacggggccgcggccgggcgg
                                            *  *** * **    *    *         

A0A7M4FPU2_BMF-01       -----tttcactctgatgactttggactcgcaggtcagcctggtgagatg
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccgg-ctgcggggcgggcac
A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccgg-ctgcggggcgggcac

A0A7M4FPU2_BMF-01       acctcta--ctggcattttcacacagaaccagtcctac------------
A0A7M4FB17_PMAIP1-      agcgccagccccgcgcc---------------------------------
A0A7M4F197_BCL2L11      agcgcggacccgccgctctctcgccctcccagtcccaacacagcaagttt
A0A7M4F197_BCL2L11      agcgcggacccgccgctctctcgccctcccagtcccaacacagcaagttt
                        * * *    *   *                                    

A0A7M4FPU2_BMF-01       ----------------------------agctgccttttggggagatttc
A0A7M4FB17_PMAIP1-      -----------------------agccatgctgc----------------
A0A7M4F197_BCL2L11      cgggcagagccgggagggctcggagcggagctgcttggctcgcaagtttc
A0A7M4F197_BCL2L11      cgggcagagccgggagggctcggagcggagctgcttggctcgcaagtttc

A0A7M4FPU2_BMF-01       a---------------acttttcccacttactcactgct-------gtgg
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      acttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgc
A0A7M4F197_BCL2L11      acttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgc

A0A7M4FPU2_BMF-01       tcctggcagca-------ggcatactgagcagcaggataaggca------
A0A7M4FB17_PMAIP1-      -ccgagcggga---------------------------------------
A0A7M4F197_BCL2L11      tccggtcgggaccgctgggggtttttggtctgtggaaaaaggcagtgcgt
A0A7M4F197_BCL2L11      tccggtcgggaccgctgggggtttttggtctgtggaaaaaggca------
                         **   * * *                                       

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      tgttgtcgtatttctttgtttgtttgtttgtctgtctgtttgtgcggagc
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      agttgcgggagatgctttgcatccagtcacttccctgatttaatcctgtc
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      ggacggagcttgtttctcagaacttggggatggcgctgtgtggctgcaaa
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      gccccgatgttgtgtcgctgtggagccgggagagcttactcgcgatgctt
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4FPU2_BMF-01       ------------------------actcaaacactcaacccatcctcttc
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      tctctttctctgcagggaaaaaaagaccaaatggcaaaacaaccctct--
A0A7M4F197_BCL2L11      ---------------ggaaaaaaagaccaaatggcaaaacaaccctct--

A0A7M4FPU2_BMF-01       cagtcaggatgtaatgttgccttgtggagtcactgaagagccccagagac
A0A7M4FB17_PMAIP1-      -------------------------ag---cagtgaga------------
A0A7M4F197_BCL2L11      -------gatttgaattccaagtgcgg---cagtgaagacagacagttgc
A0A7M4F197_BCL2L11      -------gatttgaattccaagtgcgg---cagtgaagacagacagttgc
                                                  *   ** ***              

A0A7M4FPU2_BMF-01       tcttctatggga----acgttgggtaccgtttacgtgttcccccagttgg
A0A7M4FB17_PMAIP1-      ----------------gagtgcg-----------------cct-------
A0A7M4F197_BCL2L11      agccccgtgaaaggccaagtcag-----------------cctcagcccg
A0A7M4F197_BCL2L11      agccccgtgaaaggccaagtcag-----------------cctcagcccg
                                          **  *                 **        

A0A7M4FPU2_BMF-01       ctttgctctgagtccacacctcca--------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      ttaggcctggggcccctacctctatacaaacacagtatcaa---------
A0A7M4F197_BCL2L11      ttaggcctggggcccctacctctatacaaacacagtatcaagacaggagt

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      cctgcgcctatgagttgcgacaagtccacacagactccaagtcccccatg

A0A7M4FPU2_BMF-01       --------------------------------------------------
A0A7M4FB17_PMAIP1-      --------------------------------------------------
A0A7M4F197_BCL2L11      ----------------------------------------------gctt
A0A7M4F197_BCL2L11      tcaagcctttaatcattatttaagtgcaatgggtaagcaagatcatgctt

A0A7M4FPU2_BMF-01       ----agaggaacatcaggaaggtcaccaagaagtacgtgctgaggtccaa
A0A7M4FB17_PMAIP1-      ---------------------------------tgcagc-----------
A0A7M4F197_BCL2L11      ccaggtggcaatatcgatcaatacctgaagatatgcagccagaaatatgg
A0A7M4F197_BCL2L11      ccaggtggcaatatcgatcaatacctgaagatatgcagccagaaatatgg
                                                         * *              

A0A7M4FPU2_BMF-01       attgcacggaaattacagtgtattgcagac-----cagttccaccggctc
A0A7M4FB17_PMAIP1-      -------------tgcgccggatcggagac-----cagtgccacctg---
A0A7M4F197_BCL2L11      attgcacaggaattacggcggattggagacgaatttaatgcttcctattg
A0A7M4F197_BCL2L11      attgcacaggaattacggcggattggagacgaatttaatgcttcctattg
                                     * *   * ** * ****      * * *  **     

A0A7M4FPU2_BMF-01       cacgtacaaaggcatcagcagaacagaaatcaagtgtggtggcagatact
A0A7M4FB17_PMAIP1-      ---------------------------------------caccagaagat
A0A7M4F197_BCL2L11      cccaagacggggcttctg--ggataaccaaggagtaaatcaccaaattat
A0A7M4F197_BCL2L11      cccaagacggggcttctg--ggataaccaaggagtaaatcaccaaattat
                                                                  ** *   *

A0A7M4FPU2_BMF-01       tct----cttcctacataat----ttggccttaaatgtggaggcaaacag
A0A7M4FB17_PMAIP1-      tttgggtctcattgcaaaac-ttttccgccct---------gg-------
A0A7M4F197_BCL2L11      tttgcgcctc-ttgcattatatcatccgcctcatttggagaag-------
A0A7M4F197_BCL2L11      tttgcgcctc-ttgcattatatcatccgcctcatttggagaag-------
                        * *    **   * **  *     *  ***            *       

A0A7M4FPU2_BMF-01       gaatcaagcaggtcagaggtga
A0A7M4FB17_PMAIP1-      ---------------aacgtga
A0A7M4F197_BCL2L11      ---------------acagtga
A0A7M4F197_BCL2L11      ---------------acagtga

© 1998-2022Legal notice