Dataset for CDS BAD of organism Cricetulus griseus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C2M216_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cricetulus griseus GN=BAD (length=462 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccggagcct
ggggaacgacgcaggaggaaggcggcggagaccagcaggtcgacggcaggggtgggacctggcttgggaaggtcccccag
gtccctgcctggccccaggtctcctggggagcatcagacaccaacaggaacaggcagccaacagcagtcatcatggaggc
actggggctatggagatccggagtcgccacagttcatacaccgcggggaacgaggaggatgacgggatggaggaggagct
cagcccatttcgcggccgctcacgttcggctccccctaatctctgggctgcgcagcgctacggccgcgagctccgaagga
tgagcgatgagtttgagggttccttcaaggtgaaactgactcccttccggtgcgtgcaatag
>gnl|bcl2dbcds|A0A8C2M216_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cricetulus griseus GN=BAD (length=555 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccggagcct
ggggaacgacgcaggaggaaggcggcggagaccagcaggtcgacggcaggggtgggacctggcttgggaaggtcccccag
gtccctgcctggccccaggtctcctggggagcatcagacaccaacaggaacaggcagccaacagcagtcatcatggaggc
actggggctatggagatccggagtcgccacagttcatacaccgcggggaacgaggaggatgacgggatggaggaggagct
cagcccatttcgcggccgctcacgttcggctccccctaatctctgggctgcgcagcgctacggccgcgagctccgaagga
tgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggaactgcaacacagatgcgacaaagc
gccagctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccgccccctctcagtga
© 1998-2022Legal notice