Dataset for CDS BAD of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2M216_BAD-01      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcgt
A0A8C2M216_BAD-02      atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcgt
                       **************************************************

A0A8C2M216_BAD-01      gaggaagtccgatcccggaatccggagcctggggaacgacgcaggaggaa
A0A8C2M216_BAD-02      gaggaagtccgatcccggaatccggagcctggggaacgacgcaggaggaa
                       **************************************************

A0A8C2M216_BAD-01      ggcggcggagaccagcaggtcgacggcaggggtgggacctggcttgggaa
A0A8C2M216_BAD-02      ggcggcggagaccagcaggtcgacggcaggggtgggacctggcttgggaa
                       **************************************************

A0A8C2M216_BAD-01      ggtcccccaggtccctgcctggccccaggtctcctggggagcatcagaca
A0A8C2M216_BAD-02      ggtcccccaggtccctgcctggccccaggtctcctggggagcatcagaca
                       **************************************************

A0A8C2M216_BAD-01      ccaacaggaacaggcagccaacagcagtcatcatggaggcactggggcta
A0A8C2M216_BAD-02      ccaacaggaacaggcagccaacagcagtcatcatggaggcactggggcta
                       **************************************************

A0A8C2M216_BAD-01      tggagatccggagtcgccacagttcatacaccgcggggaacgaggaggat
A0A8C2M216_BAD-02      tggagatccggagtcgccacagttcatacaccgcggggaacgaggaggat
                       **************************************************

A0A8C2M216_BAD-01      gacgggatggaggaggagctcagcccatttcgcggccgctcacgttcggc
A0A8C2M216_BAD-02      gacgggatggaggaggagctcagcccatttcgcggccgctcacgttcggc
                       **************************************************

A0A8C2M216_BAD-01      tccccctaatctctgggctgcgcagcgctacggccgcgagctccgaagga
A0A8C2M216_BAD-02      tccccctaatctctgggctgcgcagcgctacggccgcgagctccgaagga
                       **************************************************

A0A8C2M216_BAD-01      tgagcgatgagtttgagggttccttcaaggt-------------------
A0A8C2M216_BAD-02      tgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagc
                       ******************************                    

A0A8C2M216_BAD-01      ---gaaactg--------------------------------------ac
A0A8C2M216_BAD-02      gcaggaactgcaacacagatgcgacaaagcgccagctggacgcgcattat
                          * *****                                      * 

A0A8C2M216_BAD-01      tcccttccggtg-----------cgtgcaatag-----------------
A0A8C2M216_BAD-02      ccagtcctggtgggatcgaaacttgggcaaaggaggctccgccccctctc
                        *  * * ****            * ****  *                 

A0A8C2M216_BAD-01      -----
A0A8C2M216_BAD-02      agtga
                            

© 1998-2022Legal notice