Dataset for CDS classical BH3-containing proteins of organism Coturnix japonica

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C2T4E6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Coturnix japonica GN=PMAIP1 (length=354 residues).
atgcccggcaggacgatacgcaaacctgctccacccgccgagcctgcaggtagggcgaggagaaaggagacaggtctcag
gtgtttttattgcgggggagagtttgatgctggaaaaaaacacgcttttcctttttcctcttcctttttctacttgatat
tcttcttgctttcccctgtgccgctacctggaatagacctcgctcgaattaaatccccacctccctgcgcgtgccttgca
gagagggacgcggtggctgagtgcgccgtggagctgcgcaggatcggcgacaaggcggacctcaggcagaagatcctgaa
cctcatcactaaactcttctgccccaagacgtga
>gnl|bcl2dbcds|A0A8C2TW35_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Coturnix japonica GN=BCL2L11 (length=459 residues).
atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggccgggcggctgccgccgggagaggggccgggccc
ggccgtcccgttgcggcccggagcccccgccgcgttgcccggcgccgcccggcccgcctcgcccggcagccccgggccgt
tcgccatccgctcgccgctcttcttcttcgtgcggagatccccgctgctgcagcgctcctccagcgggtacttctccttc
gaggccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccccagcccgccgtgccaggccgtcagcca
ctacctgagcgccatgggtgaggaattgggtaattcggcatcgatccaccttgacaaagaggttgagcaagcgggagtgg
ctgctgtgctatcctgtctccaagccagctccatgcactgcggatgcatggtgagctga
>gnl|bcl2dbcds|A0A8C2TYD3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Coturnix japonica GN=BMF (length=750 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagagagaaatggagtcatgggggcatagcctgagctctgctctgctcagtgccagcctgctgtcac
accacctccaccactcggcttcctctgggcactgctgttcactcgccacccagcgctgttccttgggggctgaaatgcca
agtgcagcctcgtgtggacttgccatgtaa
>gnl|bcl2dbcds|A0A8C2TYD3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Coturnix japonica GN=BMF (length=750 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagagagaaatggagtcatgggggcatagcctgagctctgctctgctcagtgccagcctgctgtcac
accacctccaccactcggcttcctctgggcactgctgttcactcgccacccagcgctgttccttgggggctgaaatgcca
agtgcagcctcgtgtggacttgccatgtaa
>gnl|bcl2dbcds|A0A8C2TYD3_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Coturnix japonica GN=BMF (length=642 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgcagaccagttccaccggctccacatacagcgg
gataagcacggagtactcacatacaccagaaaaatcttaagccacaaaacatgcttgtatctaacgtggtacattgaatg
tctaattcatcactgcgctcagaggcaatcagttcttccagaaagatcaacatccatttcaggaactggacttaaccatt
ga
>gnl|bcl2dbcds|A0A8C2TYD3_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Coturnix japonica GN=BMF (length=618 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagaggataagcacggagtactcacatacaccagaaaaatcttaa
>gnl|bcl2dbcds|A0A8C2TYD3_BMF-05 Bcl2 modifying factor gene OS=[Eukaryota] Coturnix japonica GN=BMF (length=708 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaatgtggaggcgaacag
gaaccgcactgggcagaggagtctccctgatttgtggacgcagctccaggagagcatcatcacagattcttcagctccag
tttttatcagactattatggggagagaccggtgtgacgcaaagacagcgtggtaaaattcacccatga
>gnl|bcl2dbcds|A0A8C2TYI5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Coturnix japonica GN=BCL2L11 (length=267 residues).
atggggccgggcggggagcggcggcgggaggaggaggagaagaggaggaggaggaaggggcgggcagggccggctcccgc
cgctcagcgctccgctccgcccgcagaaatacaaccagaaatatggattgcacaggagctgcggcgcatcggggatgaat
tcaatgcctcctattgtccaagaagggtaattttttcttatttttactttccatttctttacgcacggtctctaaaaggg
aaaagcttaatcatatctggaaactag
© 1998-2022Legal notice