Dataset for CDS classical BH3-containing proteins of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2TYI5_BCL2L11      atgg----------------------------------------------
A0A8C2TW35_BCL2L11      atgg-----ccaagcagccc----------------------------cc
A0A8C2T4E6_PMAIP1-      atg------cccggc----------aggacgat-----------------
A0A8C2TYD3_BMF-03       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-02       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-04       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-05       atggatcgccccagctacctggaagaggactattctagcctggatgggct
                        ***                                               

A0A8C2TYI5_BCL2L11      ---------------------------ggccgggcggggagcggcggcgg
A0A8C2TW35_BCL2L11      cgaggcgaaggcgccccgcg-----accgccgggccgggc--ggctgccg
A0A8C2T4E6_PMAIP1-      --acgcaaacctgctccacc-------cgccgagcctgca--ggtag---
A0A8C2TYD3_BMF-03       ggacgatgacgtgtttcactctgatgactttggacttgca--ggtca--g
A0A8C2TYD3_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgca--ggtca--g
A0A8C2TYD3_BMF-02       ggacgatgacgtgtttcactctgatgactttggacttgca--ggtca--g
A0A8C2TYD3_BMF-04       ggacgatgacgtgtttcactctgatgactttggacttgca--ggtca--g
A0A8C2TYD3_BMF-05       ggacgatgacgtgtttcactctgatgactttggacttgca--ggtca--g
                                                       *  *  *    **      

A0A8C2TYI5_BCL2L11      gaggaggaggaga-------------------agaggaggag--------
A0A8C2TW35_BCL2L11      ccgggagagggg--------------------ccgggcccggccgtcccg
A0A8C2T4E6_PMAIP1-      ---ggcgaggaga-------------------aaggagacaggtct-cag
A0A8C2TYD3_BMF-03       cctggtgagatgactgcaactggcattttcacacagaaccagtcctacag
A0A8C2TYD3_BMF-01       cctggtgagatgactgcaactggcattttcacacagaaccagtcctacag
A0A8C2TYD3_BMF-02       cctggtgagatgactgcaactggcattttcacacagaaccagtcctacag
A0A8C2TYD3_BMF-04       cctggtgagatgactgcaactggcattttcacacagaaccagtcctacag
A0A8C2TYD3_BMF-05       cctggtgagatgactgcaactggcattttcacacagaaccagtcctacag
                           *  ***  *                       *     *        

A0A8C2TYI5_BCL2L11      --------------gaggaagg----------------------------
A0A8C2TW35_BCL2L11      ttgcggc-----ccggag---------------cccccgccgcgttg---
A0A8C2T4E6_PMAIP1-      gtgtttttattgcgggggagagtttgat----------------------
A0A8C2TYD3_BMF-03       ctgcctt-----ctggggaggtttcaactatttcccctcacacactgctg
A0A8C2TYD3_BMF-01       ctgcctt-----ctggggaggtttcaactatttcccctcacacactgctg
A0A8C2TYD3_BMF-02       ctgcctt-----ctggggaggtttcaactatttcccctcacacactgctg
A0A8C2TYD3_BMF-04       ctgcctt-----ctggggaggtttcaactatttcccctcacacactgctg
A0A8C2TYD3_BMF-05       ctgcctt-----ctggggaggtttcaactatttcccctcacacactgctg
                                      *  *                                

A0A8C2TYI5_BCL2L11      ---------------------------ggcgggcag--------------
A0A8C2TW35_BCL2L11      ----cccggcgccgcccggcccgcctcgcccggcag-----------ccc
A0A8C2T4E6_PMAIP1-      ---------------------------gctggaaaa--------aaacac
A0A8C2TYD3_BMF-03       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A8C2TYD3_BMF-01       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A8C2TYD3_BMF-02       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A8C2TYD3_BMF-04       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
A0A8C2TYD3_BMF-05       tggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaacac
                                                   *   *  *               

A0A8C2TYI5_BCL2L11      ---ggccggctcccgccgctc-----------------------------
A0A8C2TW35_BCL2L11      cgggccgttcgccatccgctc--gccgctcttcttcttcgtg-------c
A0A8C2T4E6_PMAIP1-      ---gcttttcctttttc------------ctcttcctttttcta------
A0A8C2TYD3_BMF-03       tcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcact
A0A8C2TYD3_BMF-01       tcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcact
A0A8C2TYD3_BMF-02       tcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcact
A0A8C2TYD3_BMF-04       tcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcact
A0A8C2TYD3_BMF-05       tcagcccatcctcctccagtcaggatgttatgttgccttgtggagtcact
                           *     *      *                                 

A0A8C2TYI5_BCL2L11      --agcgctccg---------------------------------------
A0A8C2TW35_BCL2L11      ggagatccccg------ctgctgcagcgctcct--ccagcgggtacttct
A0A8C2T4E6_PMAIP1-      --------cttgatattcttct-------tgct--ttcccctgtgccgct
A0A8C2TYD3_BMF-03       gaagagccccggagactcttctatgggaatgctggttaccgcttacatgt
A0A8C2TYD3_BMF-01       gaagagccccggagactcttctatgggaatgctggttaccgcttacatgt
A0A8C2TYD3_BMF-02       gaagagccccggagactcttctatgggaatgctggttaccgcttacatgt
A0A8C2TYD3_BMF-04       gaagagccccggagactcttctatgggaatgctggttaccgcttacatgt
A0A8C2TYD3_BMF-05       gaagagccccggagactcttctatgggaatgctggttaccgcttacatgt
                                *                                         

A0A8C2TYI5_BCL2L11      ---------------------ctccgccc----gcagaaatacaacca--
A0A8C2TW35_BCL2L11      ccttcgaggccgagcgcagccccgcgcccatgagctgcgataaggccacg
A0A8C2T4E6_PMAIP1-      acctggaataga---------cctcgctc--gaatt---aaatcccca--
A0A8C2TYD3_BMF-03       ccctccagttgg---------ctttgctttggatcc---aaatctccaag
A0A8C2TYD3_BMF-01       ccctccagttgg---------ctttgctttggatcc---aaatctccaag
A0A8C2TYD3_BMF-02       ccctccagttgg---------ctttgctttggatcc---aaatctccaag
A0A8C2TYD3_BMF-04       ccctccagttgg---------ctttgctttggatcc---aaatctccaag
A0A8C2TYD3_BMF-05       ccctccagttgg---------ctttgctttggatcc---aaatctccaag
                                             *   **            * *   ***  

A0A8C2TYI5_BCL2L11      -----------------------------------gaaatatggattgca
A0A8C2TW35_BCL2L11      cagacccccag-----cccgc-cgtgccaggccgtcagccactacctgag
A0A8C2T4E6_PMAIP1-      -----cctc-------cctgcgcgtgccttgcagagagg-------gacg
A0A8C2TYD3_BMF-03       aagagcctcaggaaggtcagcgggaggcacgtactgaggtgcagattgca
A0A8C2TYD3_BMF-01       aagagcctcaggaaggtcagcgggaggcacgtactgaggtgcagattgca
A0A8C2TYD3_BMF-02       aagagcctcaggaaggtcagcgggaggcacgtactgaggtgcagattgca
A0A8C2TYD3_BMF-04       aagagcctcaggaaggtcagcgggaggcacgtactgaggtgcagattgca
A0A8C2TYD3_BMF-05       aagagcctcaggaaggtcagcgggaggcacgtactgaggtgcagattgca
                                                            *             

A0A8C2TYI5_BCL2L11      caggagctgcggcgcatcggggatgaattcaat-gcctcc----------
A0A8C2TW35_BCL2L11      cgccatgggtgaggaattgggt------------aattcggcatcgatcc
A0A8C2T4E6_PMAIP1-      cggtggctg-agtgcgccgtgg---agctgcgcaggatcggc--------
A0A8C2TYD3_BMF-03       cggaaattgcagtgcattgcagaccagttccaccggctccacatacagcg
A0A8C2TYD3_BMF-01       cggaaattgcagtgcattgcagaccagttccaccggctccacatacagcg
A0A8C2TYD3_BMF-02       cggaaattgcagtgcattgcagaccagttccaccggctccacatacagcg
A0A8C2TYD3_BMF-04       cggaaattgcagtgcattgcagaccagttccaccggctccacatacagcg
A0A8C2TYD3_BMF-05       cggaaattgcagtgcattgcagaccagttccaccggctccacatacagcg
                        *       *    *    *                  **           

A0A8C2TYI5_BCL2L11      -tattgtccaagaag--------------ggtaattttttcttattttta
A0A8C2TW35_BCL2L11      accttgacaaag-aggttgagcaagcgggagtggctgctg--------tg
A0A8C2T4E6_PMAIP1-      -----gacaaggcggacctca-----ggcagaagatcctg----------
A0A8C2TYD3_BMF-03       ggataagcacgg-agtactcacatacaccagaaaaatcttaagccacaaa
A0A8C2TYD3_BMF-01       gcatcagcagaacagaaatcaagtgtggtggcagcttttt----------
A0A8C2TYD3_BMF-02       gcatcagcagaacagaaatcaagtgtggtggcagcttttt----------
A0A8C2TYD3_BMF-04       gcatcagcagaacagaaatcaagtgtggtggcagcttttt----------
A0A8C2TYD3_BMF-05       gcatcagcagaacagaaatcaagtgtggtggcagcttttt----------
                               *      *               *       *           

A0A8C2TYI5_BCL2L11      ctttccatttctttacgcacggtctctaaaagggaa-------aagctta
A0A8C2TW35_BCL2L11      ctatcctgtctccaagccagctccatgcactgcgga--------------
A0A8C2T4E6_PMAIP1-      --------------aacctcat-cactaa------------------act
A0A8C2TYD3_BMF-03       acatgcttgtatctaacgtggtacattgaatgtctaattcatc----act
A0A8C2TYD3_BMF-01       --ctctttctacacaacttgg--ccttaaatgtggaggcgaacaggaacc
A0A8C2TYD3_BMF-02       --ctctttctacacaacttgg--ccttaaatgtggaggcgaacaggaacc
A0A8C2TYD3_BMF-04       --ctctttctacacaacttgg--ccttaaatgtggaggcgaacaggaacc
A0A8C2TYD3_BMF-05       --ctctttctacacaacttgg--ccttaaatgtggaggcgaacaggaacc
                                      *        *    *                     

A0A8C2TYI5_BCL2L11      atcatatctggaaa------------------------------------
A0A8C2TW35_BCL2L11      ----tgcatggtga------------------------------------
A0A8C2T4E6_PMAIP1-      cttctgccccaaga------------------------------------
A0A8C2TYD3_BMF-03       gcgct---cagagg------------------------------------
A0A8C2TYD3_BMF-01       gcactgggcagaga-----------------gaaatggagtcatgggggc
A0A8C2TYD3_BMF-02       gcactgggcagaga-----------------gaaatggagtcatgggggc
A0A8C2TYD3_BMF-04       gcactgggcagagg------------------------------------
A0A8C2TYD3_BMF-05       gcactgggcagaggagtctccctgatttgtggacgcagctccaggagagc
                            *                                             

A0A8C2TYI5_BCL2L11      --------------------------------------------------
A0A8C2TW35_BCL2L11      --------------------------------------------------
A0A8C2T4E6_PMAIP1-      --------------------------------------------------
A0A8C2TYD3_BMF-03       ----------------------------caatcagttcttccagaaagat
A0A8C2TYD3_BMF-01       atagcctgagctctgctctgctcagtgccagcctgctgtcacaccacctc
A0A8C2TYD3_BMF-02       atagcctgagctctgctctgctcagtgccagcctgctgtcacaccacctc
A0A8C2TYD3_BMF-04       ataagc---------------------acggagtactcacatac------
A0A8C2TYD3_BMF-05       atcatc---------------------acagattcttcagctccagtttt
                                                                          

A0A8C2TYI5_BCL2L11      --------------------------------------------------
A0A8C2TW35_BCL2L11      --------------------------------------------------
A0A8C2T4E6_PMAIP1-      --------------------------------------------------
A0A8C2TYD3_BMF-03       caaca-----tccatttcaggaactg------------------------
A0A8C2TYD3_BMF-01       caccactcggcttcctctgggcactgctgttcactcgccacccagcgctg
A0A8C2TYD3_BMF-02       caccactcggcttcctctgggcactgctgttcactcgccacccagcgctg
A0A8C2TYD3_BMF-04       -acca----ga---------------------------------------
A0A8C2TYD3_BMF-05       tatca----gactattatggggagag-----------------accggtg
                                                                          

A0A8C2TYI5_BCL2L11      ------------------------------------------------ct
A0A8C2TW35_BCL2L11      -----------------------------------------------gct
A0A8C2T4E6_PMAIP1-      -----------------------------------------------cgt
A0A8C2TYD3_BMF-03       ---------------------gacttaaccat-----------------t
A0A8C2TYD3_BMF-01       ttccttgggggctgaaatgccaagtgcagcctcgtgtggacttgccatgt
A0A8C2TYD3_BMF-02       ttccttgggggctgaaatgccaagtgcagcctcgtgtggacttgccatgt
A0A8C2TYD3_BMF-04       --------------------aaaat-----ct-----------------t
A0A8C2TYD3_BMF-05       tgacgcaaagacagcgtggtaaaattcaccca-----------------t
                                                                         *

A0A8C2TYI5_BCL2L11      ag
A0A8C2TW35_BCL2L11      ga
A0A8C2T4E6_PMAIP1-      ga
A0A8C2TYD3_BMF-03       ga
A0A8C2TYD3_BMF-01       aa
A0A8C2TYD3_BMF-02       aa
A0A8C2TYD3_BMF-04       aa
A0A8C2TYD3_BMF-05       ga
                          

© 1998-2022Legal notice