Dataset for CDS classical BH3-containing proteins of organism Coregonus sp balchen

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A6F9B4C5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BMF (length=528 residues).
atgtttagaatccacattgatttgaaggtcttggcagatcgccgccgtatggacgatgaggaggatgatgtgtttgagcc
agacttccactgctggcgcacagccttcagggagataaagtacgaggacaggggaacccagacacccagccctgtcctgg
cactgcccaatagtatggtgccctgcggggtggcccaggagcccagaccactcttctacggcaacgcaggctttcgattg
cacttcccagcgcagtttgagcgtgttggagaccaggggcctcagggggagcgaggggggatggagcggctcgaacagca
gccccagcagccagcacgcagcatagaggtctacattggacagaaactccaactcatcggagaccagttcctccaacaac
accttcaactgtatcaccgaaaccaaaggaacatgaggcccttgtggaggcgcctggcctcggctctgctcaccctgctg
tttgagcaggaggccgtcgctggaggggggagagcagggtggaggtga
>gnl|bcl2dbcds|A0A6F9BAV3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BAD (length=351 residues).
atgagcaccagaccacgaccaggtgggcgtgtccggctctactcagagtcccaggtgtgctcccaggttggcaaaaggga
agacacagagtttcaggatgtgatgactcctactgaggagggcgggggtgatggggcttcattccgagggcgatcacagt
ctgctcctcctgcactgtgggctgcaaagaaatatggttgccagctgaggaggatgagtgatgaatttgacacctggctc
gacaaaggggagcccaagagagggattagcccaggaggatgcaagcagaaagtctcccgaggatggttctctttcctctg
gagtccaaaggaggccgaaggcagggagtga
>gnl|bcl2dbcds|A0A6F9BGV6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BMF (length=540 residues).
atgcagggtcaccctctgccccagctgtccaagcaggacttagcagatttctgccgtatggatgatgaggaggatgatgt
gtttgtgccagactcctcccactgctggcgcacagccttcagggagataaagtacgaggacaggggcacccagacgccca
gccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagcccagaccactcttctacggcaacgca
ggctttcgattgcacttcccagcgcggtttgagcaggttggagaccaggggcctcaggagcggcatcagggggagagagg
gaggatggaaaggcttcaacagcagcctcagcagccagcacaaagcatggaggtctgcattggacagaaactccaactca
tcggagaccagttccaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggcccttgtggtggcgcctg
gcctcagctctgctcaccctgctgtttgagcaggaggccatcgctggaagggggaggtga
>gnl|bcl2dbcds|A0A6F9CA11_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BAD (length=429 residues).
atggctcagatgtttactatatcagacagcgaatcagagccctcagaggatgtaggagaaacagaaactgaccaatcggc
agccggaaaggggatgactggcggcccactaggccacgccctcaccgcccaggagctccagggtagtgggccaggggtgg
acggcgtgcccacagacggagcatctttccgggttcgctcccagtcggccccccctgccctctgggcggccaagaaatat
ggacggcagctccgacgcatgagtgacgagtttgatacatggctggataaaggggagatgaggcgggtgaagagtgcggg
agcagccaaacagatgacaaagtcccccagctggtgggcctacctgttcagccaccaagagacagagactgaacacacct
ctaccatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A6F9CQZ0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BAD (length=501 residues).
atgttcactatatcagactgcaaatcagaaccctcagaggtaggagaaacagaaaaggacaaatcagctgcaggacaggg
aatgactggaggcccactaggccacaccctcactgtacctgagatgagactggcaggagagggtcggttgaggttgaatt
cagagtcccaggccttctctacgtcccgtgggaagaggaatggggagctccagggaagggggccaggggtggacggcatt
cccacagatggagcaccttttcgggttcgctcccagtcggccccccctgccctctgggcggctaagagatacggacggca
gctccgacgaatgagtgacgagtttgatacgtggctggataaaggggagatgaagcagttgaagagtgttggagcagcca
aacagatgacacagtcccccagctggtgggcctacctgttcagtcatcaggagacagagacagaacacagccctaacctg
accgctcccgaaccacgataa
© 1998-2020Legal notice