Dataset for CDS classical BH3-containing proteins of organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6F9CA11_BAD-02      atggctcagatgtttactat-------------------------atcag
A0A6F9CQZ0_BAD-02      ---------atgttcactat-------------------------atcag
A0A6F9BAV3_BAD-01      ---------atg---------------------------------agcac
A0A6F9B4C5_BMF-01      ---------atgtttagaat---------ccacattgatttga--aggtc
A0A6F9BGV6_BMF-01      ---------atg--cagggtcaccctctgccccagctgtccaagcaggac
                                ***                                 *    

A0A6F9CA11_BAD-02      acagcgaatcagagccctcagaggatgtaggagaaacagaaactgaccaa
A0A6F9CQZ0_BAD-02      actgcaaatcagaaccctcagag---gtaggagaaacagaaaaggacaaa
A0A6F9BAV3_BAD-01      ----cagaccacgaccag--------gtgggcg----------tgtccgg
A0A6F9B4C5_BMF-01      ttggcagatcgccgccgt--------atggacgatgaggaggatgatgtg
A0A6F9BGV6_BMF-01      ttagcagatttctgccgt--------atggatgatgaggaggatgatgtg
                           *  *      **           * *  *           *     

A0A6F9CA11_BAD-02      tcggcagccggaaagg---ggatgactggcggcccactaggccacgccct
A0A6F9CQZ0_BAD-02      tcagctgcaggacagg---gaatgactggaggcccactaggccacaccct
A0A6F9BAV3_BAD-01      ct-----ctactcaga---gtccca-----ggtgt----------gctcc
A0A6F9B4C5_BMF-01      tt-----tgagccaga---cttccactgctggcgcac-------agcctt
A0A6F9BGV6_BMF-01      tt-----tgtgccagactcctcccactgctggcgcac-------agcctt
                                    **         *     **              *   

A0A6F9CA11_BAD-02      caccg---------------------------------------------
A0A6F9CQZ0_BAD-02      cactgtacctgagatgagactggcaggagagggtcggttgaggttgaatt
A0A6F9BAV3_BAD-01      ca-------------------ggttggcaaaa---------gggaagaca
A0A6F9B4C5_BMF-01      ca-------------------gggagataaagtacgaggacaggggaacc
A0A6F9BGV6_BMF-01      ca-------------------gggagataaagtacgaggacaggggcacc

A0A6F9CA11_BAD-02      ------ccca---------------------------------ggagctc
A0A6F9CQZ0_BAD-02      cagagtcccaggccttctctacgtcccgtgggaagaggaatggggagctc
A0A6F9BAV3_BAD-01      cagagtttcag---------------------------------------
A0A6F9B4C5_BMF-01      cagacacccagccctgtcctggc--------------------actgccc
A0A6F9BGV6_BMF-01      cagacgcccagccctgccctggc--------------------actgccc

A0A6F9CA11_BAD-02      cagggtagtgggcc--------aggggtggacggcgtgcccacagacgga
A0A6F9CQZ0_BAD-02      cagggaagggggcc--------aggggtggacggcattcccacagatgga
A0A6F9BAV3_BAD-01      ---gatgtgatgactcctactgaggag-ggcggggg-------tgatggg
A0A6F9B4C5_BMF-01      aatagtatggtgcc-----ctgcggggtggcccagg-------agcccag
A0A6F9BGV6_BMF-01      aacgacatgctgcc-----ctgtggggtggcccagg-------agcccag
                                  * *         ** * **              *     

A0A6F9CA11_BAD-02      gcatctttccgggttcgctcccagtc-------ggccccccc---tgccc
A0A6F9CQZ0_BAD-02      gcaccttttcgggttcgctcccagtc-------ggccccccc---tgccc
A0A6F9BAV3_BAD-01      gcttcattccgagggcgatcacagtc-------tgctcctcc---tgcac
A0A6F9B4C5_BMF-01      accactcttctacggcaa-cgcaggctttcgattgcacttcccagcgcag
A0A6F9BGV6_BMF-01      accactcttctacggcaa-cgcaggctttcgattgcacttcccagcgcgg
                        *  *  * *     *   * *** *        ** *  **    **  

A0A6F9CA11_BAD-02      tctgggcggccaagaaatatggacggc--------------------agc
A0A6F9CQZ0_BAD-02      tctgggcggctaagagatacggacggc--------------------agc
A0A6F9BAV3_BAD-01      tgtgggctgcaaagaaatatggttgcc--------------------agc
A0A6F9B4C5_BMF-01      tttgagcgtgttggagaccagg-ggcc------------tcagggggagc
A0A6F9BGV6_BMF-01      tttgagcaggttggagaccagg-ggcctcaggagcggcatcagggggaga
                       * ** **      ** *   **  * *                    ** 

A0A6F9CA11_BAD-02      tccgacgcatgagtgacgagtttgatacatggctggata-----------
A0A6F9CQZ0_BAD-02      tccgacgaatgagtgacgagtttgatacgtggctggata-----------
A0A6F9BAV3_BAD-01      tgaggaggatgagtgatgaatttgacacctggctcgaca-----------
A0A6F9B4C5_BMF-01      gaggggggatgg--agcggctcgaacagcagccccagcagccagcacgca
A0A6F9BGV6_BMF-01      gagggaggatgg--aaaggcttcaacagcagcctcagcagccagcacaaa
                          *  * ***      *  *   * *   * *     *           

A0A6F9CA11_BAD-02      -------------------aaggggagatgaggcgggtgaagagtg----
A0A6F9CQZ0_BAD-02      -------------------aaggggagatgaagcagttgaagagtg----
A0A6F9BAV3_BAD-01      -------------------aaggggagcccaa-------gagagggatta
A0A6F9B4C5_BMF-01      gcatagaggtctacattggacagaaactccaactcatcggagaccagttc
A0A6F9BGV6_BMF-01      gcatggaggtctgcattggacagaaactccaactcatcggagaccagttc
                                          *  *  *    *         ***       

A0A6F9CA11_BAD-02      ---cgggagcagc-------------------caaacagatgacaaagtc
A0A6F9CQZ0_BAD-02      ---ttggagcagc-------------------caaacagatgacacagtc
A0A6F9BAV3_BAD-01      gcccaggag-------------------gatgcaagcagaa----agtct
A0A6F9B4C5_BMF-01      ctccaacaacaccttcaactgtatcaccgaaaccaaaggaacatgaggcc
A0A6F9BGV6_BMF-01      caccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggcc
                              *                        * *   **          

A0A6F9CA11_BAD-02      ccccagctgg----------tgggcctacctgttcagccacc-----aag
A0A6F9CQZ0_BAD-02      ccccagctgg----------tgggcctacctgttcagtcatc-----agg
A0A6F9BAV3_BAD-01      cccgagga------------tggttctctttcctctggagtccaa--agg
A0A6F9B4C5_BMF-01      cttgtggaggcgcctggcctcggctctgctcaccctgctgtttgagcagg
A0A6F9BGV6_BMF-01      cttgtggtggcgcctggcctcagctctgctcaccctgctgtttgagcagg
                       *    *                *  **       * *          * *

A0A6F9CA11_BAD-02      agac--------agagactgaacacacctct------accatccc---ac
A0A6F9CQZ0_BAD-02      agac--------agagacagaacacagccctaacctgaccgctcccgaac
A0A6F9BAV3_BAD-01      aggcc-------gaaggca-----------gggagtga------------
A0A6F9B4C5_BMF-01      aggccgtcgctggaggggggagagcagggtggaggtga------------
A0A6F9BGV6_BMF-01      aggccatcgctggaaggg------------ggaggtga------------
                       ** *           *                     *            

A0A6F9CA11_BAD-02      cacgatcatctgagtag
A0A6F9CQZ0_BAD-02      cacgataa---------
A0A6F9BAV3_BAD-01      -----------------
A0A6F9B4C5_BMF-01      -----------------
A0A6F9BGV6_BMF-01      -----------------

© 1998-2021Legal notice