Dataset for CDS BMF of organism Coregonus sp balchen

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A6F9B4C5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BMF (length=528 residues).
atgtttagaatccacattgatttgaaggtcttggcagatcgccgccgtatggacgatgaggaggatgatgtgtttgagcc
agacttccactgctggcgcacagccttcagggagataaagtacgaggacaggggaacccagacacccagccctgtcctgg
cactgcccaatagtatggtgccctgcggggtggcccaggagcccagaccactcttctacggcaacgcaggctttcgattg
cacttcccagcgcagtttgagcgtgttggagaccaggggcctcagggggagcgaggggggatggagcggctcgaacagca
gccccagcagccagcacgcagcatagaggtctacattggacagaaactccaactcatcggagaccagttcctccaacaac
accttcaactgtatcaccgaaaccaaaggaacatgaggcccttgtggaggcgcctggcctcggctctgctcaccctgctg
tttgagcaggaggccgtcgctggaggggggagagcagggtggaggtga
>gnl|bcl2dbcds|A0A6F9BGV6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BMF (length=540 residues).
atgcagggtcaccctctgccccagctgtccaagcaggacttagcagatttctgccgtatggatgatgaggaggatgatgt
gtttgtgccagactcctcccactgctggcgcacagccttcagggagataaagtacgaggacaggggcacccagacgccca
gccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagcccagaccactcttctacggcaacgca
ggctttcgattgcacttcccagcgcggtttgagcaggttggagaccaggggcctcaggagcggcatcagggggagagagg
gaggatggaaaggcttcaacagcagcctcagcagccagcacaaagcatggaggtctgcattggacagaaactccaactca
tcggagaccagttccaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggcccttgtggtggcgcctg
gcctcagctctgctcaccctgctgtttgagcaggaggccatcgctggaagggggaggtga
© 1998-2020Legal notice