Dataset for CDS BMF of organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6F9B4C5_BMF-01      atgtttagaat---------ccacattgatttga--aggtcttggcagat
A0A6F9BGV6_BMF-01      atg--cagggtcaccctctgccccagctgtccaagcaggacttagcagat
                       ***   **  *         ** **    *   *  *** *** ******

A0A6F9B4C5_BMF-01      cgccgccgtatggacgatgaggaggatgatgtgtttgagccaga---ctt
A0A6F9BGV6_BMF-01      ttctgccgtatggatgatgaggaggatgatgtgtttgtgccagactcctc
                         * ********** ********************** ******   ** 

A0A6F9B4C5_BMF-01      ccactgctggcgcacagccttcagggagataaagtacgaggacaggggaa
A0A6F9BGV6_BMF-01      ccactgctggcgcacagccttcagggagataaagtacgaggacaggggca
                       ************************************************ *

A0A6F9B4C5_BMF-01      cccagacacccagccctgtcctggcactgcccaatagtatggtgccctgc
A0A6F9BGV6_BMF-01      cccagacgcccagccctgccctggcactgcccaacgacatgctgccctgt
                       ******* ********** ***************    *** ******* 

A0A6F9B4C5_BMF-01      ggggtggcccaggagcccagaccactcttctacggcaacgcaggctttcg
A0A6F9BGV6_BMF-01      ggggtggcccaggagcccagaccactcttctacggcaacgcaggctttcg

A0A6F9B4C5_BMF-01      attgcacttcccagcgcagtttgagcgtgttggagaccaggggcc-----
A0A6F9BGV6_BMF-01      attgcacttcccagcgcggtttgagcaggttggagaccaggggcctcagg
                       ***************** ********  *****************     

A0A6F9B4C5_BMF-01      -------tcagggggagcgaggggggatggagcggctcgaacagcagccc
A0A6F9BGV6_BMF-01      agcggcatcagggggagagagggaggatggaaaggcttcaacagcagcct
                              ********** ***** *******  ****  ********** 

A0A6F9B4C5_BMF-01      cagcagccagcacgcagcatagaggtctacattggacagaaactccaact
A0A6F9BGV6_BMF-01      cagcagccagcacaaagcatggaggtctgcattggacagaaactccaact
                       *************  ***** ******* *********************

A0A6F9B4C5_BMF-01      catcggagaccagttcctccaacaacaccttcaactgtatcaccgaaacc
A0A6F9BGV6_BMF-01      catcggagaccagttccaccaagaacaccttcaactgtatcaccgaaacc
                       ***************** **** ***************************

A0A6F9B4C5_BMF-01      aaaggaacatgaggcccttgtggaggcgcctggcctcggctctgctcacc
A0A6F9BGV6_BMF-01      aaaggaacatgaggcccttgtggtggcgcctggcctcagctctgctcacc
                       *********************** ************* ************

A0A6F9B4C5_BMF-01      ctgctgtttgagcaggaggccgtcgctggaggggggagagcagggtggag
A0A6F9BGV6_BMF-01      ctgctgtttgagcaggaggccatcgctggaaggg------------ggag
                       ********************* ******** ***            ****

A0A6F9B4C5_BMF-01      gtga
A0A6F9BGV6_BMF-01      gtga

© 1998-2021Legal notice