Dataset for CDS classical BH3-containing proteins of organism Chinchilla lanigera

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C2UGS8_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Chinchilla lanigera GN=BBC3 (length=585 residues).
atggcccgtgcacgccaggagggcagctctccggagcccgtagagggcctggcccgcgacggccctcgccccttccccct
cggccgcctggtgccctcagctgtgtcctgcggtctctgcgaacccggccttcctgctgcccccaccaccacccctgccc
tgctgcccgcggcctacctctgcgcccccaccgcaccacccgcccttacagccgcactggggggcccccgctggcctggg
ggcccccgcagccggccccgaggcccgcgccctgatggtcctcagccacccctctcggcggccgagcagcacctagagtc
gcccgtgcccagcgccccggaggccctggcgggcggtcccacccaggcggcccccggggtccggggggaggaggagcagt
gggcccgggagatcggggcgcagctgcggcggatggcggacgacctcaacgcgcagtacgagcggaggagacaagaggag
cagcagcgacaccgcccgtcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacgg
agcccccgagatggagcccaattag
>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=333 residues).
atggccaagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccacccca
gctcaggcctggggccctgacctccctacagacggagccccaagcttccatgaggcagtctcaggctgaacctccggatt
tgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaaggagggtattc
ttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtccgcctggtgtg
gaggatgcactga
>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=897 residues).
acacgcccgggtcggcggcgctcgcggcagggaacccggaggggccagccccgcctttacctgtcccagcctgcacgcgc
cggcagccctcgcggcgcgggggcgggacttgccctccctcgcgcggaggcgggacttggcgggggcggggcccgcggtg
attggacgcgggcgcggagccgccagtcggagctgggctgccgggccgcacaggtttcacttcgctccgcgcagcctctg
ggtgctgagcttgctggagcgcagcgtcccgcgccgtcaccgccgccacaccaccgccgccagcgtattcttacagttcc
cctgcgagccttgccccactgcagtcagcaccgtcttcggcagctccagttgccccgctcccgccgccaccgcctcggcg
cccttccctggccctggtacccccaatgtctgactctgattctcgaactgagaagcgcaagaaaaaaagaccaaatggcc
aagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccaccccagctcag
gcctggggccctgacctccctacagacggagccccaagacaggagcccggcacctatgagttgtgacaaatcaacacaaa
ccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgaacctccg
gatttgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaaggagggt
attcttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtccgcctgg
tgtggaggatgcactga
>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccacccca
gctcaggcctggggccctgacctccctacagacggagccccaagacaggagcccggcacctatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgaa
cctccggatttgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaag
gagggtattcttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtcc
gcctggtgtggaggatgcactga
>gnl|bcl2dbcds|A0A8C2VBL6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Chinchilla lanigera GN=BMF (length=780 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggtgtgccctggcctcctccgcgcccgccccccgcgccgccc
gcctcccgccgcactgggctttcccctccttccccaccgagtctgggcgcccagcccccgagtgctcgtcacgctggacc
ctggcgcagagccctggcaccacgactcggaggccgattctctctcctggagtcacccaggggagatggagccacctcag
tgtgtggaggagctggaagatgatgtattccaacctgaggatggggagccggggacccagcccgggagcctgctctctgc
tgatctgtttgcccagagccagctggattgtccccttggtcggctgcacctcttccctctcacccactgctgtggccctg
ggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccagggtgtcatgctgcct
tgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccctgccagtttccctgc
aggcttgccccttgaggagcagcccccggaaggtcagtggcaacatcgcgcagaggtacagatcgcccggaagcttcggt
gcattgcagaccagttccaccggcttcacatgcaacaacgccaacagaaccagaatcgcgtgtggtggcaggtcctactc
ttcctgcacaacctgggtctgaatggagaagagaacagagaaggggtgggtcccaggtga
>gnl|bcl2dbcds|A0A8C2VWH6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Chinchilla lanigera GN=PMAIP1 (length=318 residues).
atgccgggaaaggtgtgtaagagcacgccgccgccgaactccacgcgggcaccggcagagctggcagctgagtgtgctgc
tcagcataggagaatcggagacaaactgaatgccctgggttgtgccacggagatcctggagacgcttgcagagatgcctg
ggaagaaagctcggaagagcgcgcagctgactctgaccggggcacccgcagagctggaagtcgagtgtgccgctcagttc
agaagaattggagataaactgaatttccggcagaaacttatgaatttgatttccaaactcttcagtttagtaacctga
>gnl|bcl2dbcds|A0A8C2W470_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chinchilla lanigera GN=BAD (length=585 residues).
atgcggactccagagaagccctcacccgctcctacccacgccgaaagtttaaggaagtctgagcagggcatccggagact
tggggcagcccagagcatgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcc
tgggccccggccccacgggggaccggctaggcagcaacacagcaggaggcttcctgggggacaccagtcaccagcagagg
cagctgagaagcagcagccaccatggaggcgctggggctatggacacccggagtcgccacagctcatatcccacagggat
ggaggaagaggaagggatggaggaggagcccagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctg
cacagcgctacggccgagagctccggaggatgagcgatgaattcgtggactccttcaagggtcttcctcgcccgaagagc
gcgggtacagcgacgaagctgtggcagagctccaactggacacgcgccatccagtcctggtgggatcggaacttggggag
aggaggctctgccccctcccagtga
>gnl|bcl2dbcds|A0A8C2W470_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chinchilla lanigera GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcctgggccccggccccac
gggggaccggctaggcagcaacacagcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaagcagca
gccaccatggaggcgctggggctatggacacccggagtcgccacagctcatatcccacagggatggaggaagaggaaggg
atggaggaggagcccagtccattccggggccgctcgcgctcggcgcctcccaacctctgggctgcacagcgctacggccg
agagctccggaggatgagcgatgaattcgtggactccttcaagggtcttcctcgcccgaagagcgcgggtacagcgacga
agctgtggcagagctccaactggacacgcgccatccagtcctggtgggatcggaacttggggagaggaggctctgccccc
tcccagtga
© 1998-2022Legal notice